EMAIL THIS PAGE TO A FRIEND

UGT1A3

UDP glucuronosyltransferase 1 family, polypeptide A3

Synonyms: UDPGT UDPGT 1-3 UGT-1C UGT1-03 UGT1.3 UGT1C
UniProtKB ID: P35503
Gene ID:
Human(54659) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. Substrates of this enzyme include estrone, 2-hydroxyestrone, and metabolites of benzo alpha-pyrene. [provided by RefSeq, Jul 2008]
Rat(396551) UDP glycosyltransferase 1 family, polypeptide A3
sheep(100534645) UDP glucuronosyltransferase 1 family, polypeptide A3
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0054659M2 Monoclonal Anti-UGT1A3 antibody produced in mouse clone 1C10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019093 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219141 MISSION® esiRNA esiRNA targeting human UGT1A3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019093 Rosetta Predictions human pricing
NM_201424 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055092 predicted 2082
2 SASI_Hs01_00055093 predicted 1660
3 SASI_Hs01_00055095 predicted 2000
4 SASI_Hs02_00352703 predicted 1903
5 SASI_Hs01_00055096 predicted 1528
6 SASI_Hs01_00055097 predicted 2000
7 SASI_Hs01_00055098 predicted 2085
8 SASI_Hs01_00055099 predicted 2012
9 SASI_Hs01_00055101 predicted 2073
10 SASI_Hs02_00352704 predicted 1579
11 SASI_Hs01_00055094 predicted 1575
12 SASI_Hs01_00055100 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054102 predicted 1450
2 SASI_Rn01_00054103 predicted 1424
3 SASI_Rn01_00054104 predicted 1234
4 SASI_Rn01_00054105 predicted 1488
5 SASI_Rn01_00054106 predicted 1357
6 SASI_Rn02_00270323 predicted 1116
7 SASI_Rn02_00270324 predicted 1110
8 SASI_Rn01_00054107 predicted 1118
9 SASI_Rn01_00054108 predicted 1242
10 SASI_Rn02_00270325 predicted 1102
11 SASI_Rn01_00054109 predicted 1228
12 SASI_Rn01_00054110 predicted 2004
13 SASI_Rn01_00054111 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019093
UGT1A3 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-733s1c1
Sequence:CCGGGTGGTGGATATTCTCAGTCATCTCGAGATGACTGAGAATATCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-333s1c1
Sequence:CCGGCAGAAGTATGGCAATGTTGAACTCGAGTTCAACATTGCCATACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-201s1c1
Sequence:CCGGGCACATCAAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-856s1c1
Sequence:CCGGCCACTATCTCAGGAATTTGAACTCGAGTTCAAATTCCTGAGATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019093.2-258s21c1
Sequence:CCGGGGATGAATTTGATCGCCATGTCTCGAGACATGGCGATCAAATTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019093.2-284s21c1
Sequence:CCGGGCCACACTCAACTGTACTTTGCTCGAGCAAAGTACAGTTGAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019093
UGT1A3 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-733s1c1
Sequence:CCGGGTGGTGGATATTCTCAGTCATCTCGAGATGACTGAGAATATCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-333s1c1
Sequence:CCGGCAGAAGTATGGCAATGTTGAACTCGAGTTCAACATTGCCATACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-201s1c1
Sequence:CCGGGCACATCAAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-856s1c1
Sequence:CCGGCCACTATCTCAGGAATTTGAACTCGAGTTCAAATTCCTGAGATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019093.2-258s21c1
Sequence:CCGGGGATGAATTTGATCGCCATGTCTCGAGACATGGCGATCAAATTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019093.2-284s21c1
Sequence:CCGGGCCACACTCAACTGTACTTTGCTCGAGCAAAGTACAGTTGAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019093
UGT1A3 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-733s1c1
Sequence:CCGGGTGGTGGATATTCTCAGTCATCTCGAGATGACTGAGAATATCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-333s1c1
Sequence:CCGGCAGAAGTATGGCAATGTTGAACTCGAGTTCAACATTGCCATACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-201s1c1
Sequence:CCGGGCACATCAAAGAAGAGAACTTCTCGAGAAGTTCTCTTCTTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019093.2-856s1c1
Sequence:CCGGCCACTATCTCAGGAATTTGAACTCGAGTTCAAATTCCTGAGATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019093.2-258s21c1
Sequence:CCGGGGATGAATTTGATCGCCATGTCTCGAGACATGGCGATCAAATTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019093.2-284s21c1
Sequence:CCGGGCCACACTCAACTGTACTTTGCTCGAGCAAAGTACAGTTGAGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks