EMAIL THIS PAGE TO A FRIEND

UGT1A4

UDP glucuronosyltransferase 1 family, polypeptide A4

Synonyms: HUG-BR2 UDPGT UDPGT 1-4 UGT-1D UGT1-04 UGT1.4 UGT1D
UniProtKB ID: P22310, B2R937, Q5DT00
Gene ID:
Human(54657) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. This enzyme has some glucuronidase activity towards bilirubin, although is is more active on amines, steroids, and sapogenins. [provided by RefSeq, Jul 2008]
sheep(100534646) UDP glucuronosyltransferase 1 family, polypeptide A4
Zebrafish(100384901) UDP glucuronosyltransferase 1 family, polypeptide A4
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46829 Anti-UGT1A4 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300890 Anti-UGT1A4 antibody produced in rabbit affinity isolated antibody human
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
420247 (+)-Borneol 97% human pricing
224464 (1S,2R,5S)-(+)-Menthol 99% human pricing
A42409 2-Aminobiphenyl 97% human pricing
A2898 4-Aminobiphenyl human pricing
31598 4-Aminobiphenyl analytical standard human pricing
1048 4-Nitrophenol spectrophotometric grade human pricing
35836 4-Nitrophenol PESTANAL®, analytical standard human pricing
241326 4-Nitrophenol ReagentPlus®, ≥99% human pricing
48549 4-Nitrophenol Reference Material human pricing
N7660 4-Nitrophenol solution 10 mM human pricing
40056 4-Nitrophenol solution certified reference material, 5000 μg/mL in methanol human pricing
A0887 5α-Androstane human pricing
B3503 Benzidine ≥98.0% (N) human pricing
B1883 Benzidine ISOPAC®, ≥98.0% (N) human pricing
31614 Benzidine analytical standard human pricing
12115 Benzidine purum p.a., ≥98.0% (N) human pricing
W224502 Carvacrol ≥98%, FCC, FG human pricing
282197 Carvacrol 98% human pricing
D1634 Diosgenin ≥93% human pricing
45456 Diphenylamine PESTANAL®, analytical standard human pricing
33149 Diphenylamine puriss. p.a., redox indicator, ACS reagent, reag. Ph. Eur., ≥98% (GC) human pricing
242586 Diphenylamine ACS reagent, ≥99% human pricing
112763 Diphenylamine ReagentPlus®, 99% human pricing
35995 Eugenol PESTANAL®, analytical standard human pricing
46129 Eugenol tested according to Ph.Eur. human pricing
E51791 Eugenol ReagentPlus®, 99% human pricing
W246700 Eugenol ≥98%, FCC, FG human pricing
W246719 Eugenol natural, ≥98%, FG human pricing
D7802 Daidzein ≥98%, synthetic human, mouse, rat pricing
C6305 Clozapine human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007120 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222991 MISSION® esiRNA esiRNA targeting human UGT1A4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007120 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082569 predicted 2113
2 SASI_Hs01_00082570 predicted 1698
3 SASI_Hs01_00082572 predicted 2027
4 SASI_Hs02_00342992 predicted 1930
5 SASI_Hs01_00082573 predicted 1556
6 SASI_Hs01_00082574 predicted 2026
7 SASI_Hs01_00082575 predicted 2114
8 SASI_Hs01_00082576 predicted 2043
9 SASI_Hs01_00082578 predicted 2108
10 SASI_Hs02_00342993 predicted 1608
11 SASI_Hs01_00082571 predicted 1597
12 SASI_Hs01_00082577 predicted 1553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007120
UGT1A4 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-356s21c1
Sequence:CCGGATATTCTAGAAGTATGGCAATCTCGAGATTGCCATACTTCTAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-303s21c1
Sequence:CCGGGTTACGCTGGGCTACACTCAACTCGAGTTGAGTGTAGCCCAGCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-601s21c1
Sequence:CCGGCCTCCTATATTCCTAAGTTACCTCGAGGTAACTTAGGAATATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-259s1c1
Sequence:CCGGTGACAGCCTATGCTGTTCCATCTCGAGATGGAACAGCATAGGCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-286s1c1
Sequence:CCGGAGAAGGAATTTGATCGCGTTACTCGAGTAACGCGATCAAATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-612s1c1
Sequence:CCGGCCTAAGTTACTAACGACCAATCTCGAGATTGGTCGTTAGTAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-339s1c1
Sequence:CCGGGAACATCTTCTGAAGAGATATCTCGAGATATCTCTTCAGAAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-391s1c1
Sequence:CCGGCTTTGGCCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007120
UGT1A4 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-356s21c1
Sequence:CCGGATATTCTAGAAGTATGGCAATCTCGAGATTGCCATACTTCTAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-303s21c1
Sequence:CCGGGTTACGCTGGGCTACACTCAACTCGAGTTGAGTGTAGCCCAGCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-601s21c1
Sequence:CCGGCCTCCTATATTCCTAAGTTACCTCGAGGTAACTTAGGAATATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-259s1c1
Sequence:CCGGTGACAGCCTATGCTGTTCCATCTCGAGATGGAACAGCATAGGCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-286s1c1
Sequence:CCGGAGAAGGAATTTGATCGCGTTACTCGAGTAACGCGATCAAATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-612s1c1
Sequence:CCGGCCTAAGTTACTAACGACCAATCTCGAGATTGGTCGTTAGTAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-339s1c1
Sequence:CCGGGAACATCTTCTGAAGAGATATCTCGAGATATCTCTTCAGAAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-391s1c1
Sequence:CCGGCTTTGGCCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007120
UGT1A4 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-356s21c1
Sequence:CCGGATATTCTAGAAGTATGGCAATCTCGAGATTGCCATACTTCTAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-303s21c1
Sequence:CCGGGTTACGCTGGGCTACACTCAACTCGAGTTGAGTGTAGCCCAGCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-601s21c1
Sequence:CCGGCCTCCTATATTCCTAAGTTACCTCGAGGTAACTTAGGAATATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-259s1c1
Sequence:CCGGTGACAGCCTATGCTGTTCCATCTCGAGATGGAACAGCATAGGCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-286s1c1
Sequence:CCGGAGAAGGAATTTGATCGCGTTACTCGAGTAACGCGATCAAATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-612s1c1
Sequence:CCGGCCTAAGTTACTAACGACCAATCTCGAGATTGGTCGTTAGTAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-339s1c1
Sequence:CCGGGAACATCTTCTGAAGAGATATCTCGAGATATCTCTTCAGAAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-391s1c1
Sequence:CCGGCTTTGGCCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks