EMAIL THIS PAGE TO A FRIEND

UGT1A5

UDP glucuronosyltransferase 1 family, polypeptide A5

Synonyms: UDPGT UDPGT 1-5 UGT1E
UniProtKB ID: P35504
Gene ID:
Human(54579) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. [provided by RefSeq, Jul 2008]
Mouse(394433) UDP glucuronosyltransferase 1 family, polypeptide A5
Rat(574523) UDP glucuronosyltransferase 1 family, polypeptide A5
Zebrafish(100384897) UDP glucuronosyltransferase 1 family, polypeptide A5
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105725 Anti-UGT1A5, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019078 Rosetta Predictions human pricing
NM_001039549 Rosetta Predictions rat pricing
NM_201643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015797 predicted 2085
2 SASI_Hs01_00015798 predicted 1667
3 SASI_Hs01_00015800 predicted 1995
4 SASI_Hs02_00352674 predicted 1899
5 SASI_Hs01_00015801 predicted 1528
6 SASI_Hs01_00015802 predicted 2001
7 SASI_Hs01_00015803 predicted 2090
8 SASI_Hs01_00015804 predicted 2011
9 SASI_Hs01_00015806 predicted 2076
10 SASI_Hs02_00352675 predicted 1576
11 SASI_Hs01_00015799 predicted 1574
12 SASI_Hs01_00015805 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030394 predicted 1483
2 SASI_Rn01_00030395 predicted 1464
3 SASI_Rn01_00030396 predicted 1270
4 SASI_Rn01_00030397 predicted 1529
5 SASI_Rn01_00030398 predicted 1394
6 SASI_Rn02_00204853 predicted 1154
7 SASI_Rn02_00204854 predicted 1141
8 SASI_Rn01_00030399 predicted 1148
9 SASI_Rn01_00030400 predicted 1270
10 SASI_Rn02_00204855 predicted 1133
11 SASI_Rn01_00030401 predicted 1264
12 SASI_Rn01_00030402 predicted 2039
13 SASI_Rn01_00030403 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351731 predicted 1152
2 SASI_Mm02_00351732 predicted 1321
3 SASI_Mm02_00351733 predicted 1144
4 SASI_Mm02_00351734 predicted 1381
5 SASI_Mm01_00047577 predicted 1359
6 SASI_Mm02_00351735 predicted 1255
7 SASI_Mm02_00351736 predicted 1169
8 SASI_Mm02_00351737 predicted 1168
9 SASI_Mm02_00351738 predicted 1157
10 SASI_Mm02_00351739 predicted 1216
11 SASI_Mm01_00047570 predicted 1597
12 SASI_Mm01_00047571 predicted 1647
13 SASI_Mm01_00047572 predicted 1403
14 SASI_Mm01_00047573 predicted 1489
15 SASI_Mm01_00047574 predicted 1549
16 SASI_Mm01_00047575 predicted 1640
17 SASI_Mm01_00047576 predicted 1595
18 SASI_Mm01_00047578 predicted 1514
19 SASI_Mm01_00047579 predicted 1645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019078
UGT1A5 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-257s1c1
Sequence:CCGGAGGACGAATTTGATCGCCTTTCTCGAGAAAGGCGATCAAATTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-583s1c1
Sequence:CCGGCCTAGATTACTAACGACCAATCTCGAGATTGGTCGTTAGTAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-286s1c1
Sequence:CCGGCACACTCAATCGTTCTTTGAACTCGAGTTCAAAGAACGATTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-672s1c1
Sequence:CCGGCCATGCTGTTTCTGCTCCTTACTCGAGTAAGGAGCAGAAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-362s1c1
Sequence:CCGGCTTTGATCATACATAGGTCTTCTCGAGAAGACCTATGTATGATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019078
UGT1A5 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-257s1c1
Sequence:CCGGAGGACGAATTTGATCGCCTTTCTCGAGAAAGGCGATCAAATTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-583s1c1
Sequence:CCGGCCTAGATTACTAACGACCAATCTCGAGATTGGTCGTTAGTAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-286s1c1
Sequence:CCGGCACACTCAATCGTTCTTTGAACTCGAGTTCAAAGAACGATTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-672s1c1
Sequence:CCGGCCATGCTGTTTCTGCTCCTTACTCGAGTAAGGAGCAGAAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-362s1c1
Sequence:CCGGCTTTGATCATACATAGGTCTTCTCGAGAAGACCTATGTATGATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019078
UGT1A5 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-257s1c1
Sequence:CCGGAGGACGAATTTGATCGCCTTTCTCGAGAAAGGCGATCAAATTCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-583s1c1
Sequence:CCGGCCTAGATTACTAACGACCAATCTCGAGATTGGTCGTTAGTAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-286s1c1
Sequence:CCGGCACACTCAATCGTTCTTTGAACTCGAGTTCAAAGAACGATTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-672s1c1
Sequence:CCGGCCATGCTGTTTCTGCTCCTTACTCGAGTAAGGAGCAGAAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019078.1-362s1c1
Sequence:CCGGCTTTGATCATACATAGGTCTTCTCGAGAAGACCTATGTATGATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201643
UGT1A5 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201643.1-1813s1c1
Sequence:CCGGCTAGTATATGTGATGTGCTTTCTCGAGAAAGCACATCACATATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-269s1c1
Sequence:CCGGGCCGTTCCCTATACAAGACAACTCGAGTTGTCTTGTATAGGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-218s1c1
Sequence:CCGGGAGGTGAACATGCGCATCAAACTCGAGTTTGATGCGCATGTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-1595s1c1
Sequence:CCGGCGAGTGAAGAAATCACACAAACTCGAGTTTGTGTGATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-456s1c1
Sequence:CCGGGCTCCTTTGATGTAGTCTTTACTCGAGTAAAGACTACATCAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201643
UGT1A5 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201643.1-1813s1c1
Sequence:CCGGCTAGTATATGTGATGTGCTTTCTCGAGAAAGCACATCACATATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-269s1c1
Sequence:CCGGGCCGTTCCCTATACAAGACAACTCGAGTTGTCTTGTATAGGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-218s1c1
Sequence:CCGGGAGGTGAACATGCGCATCAAACTCGAGTTTGATGCGCATGTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-1595s1c1
Sequence:CCGGCGAGTGAAGAAATCACACAAACTCGAGTTTGTGTGATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-456s1c1
Sequence:CCGGGCTCCTTTGATGTAGTCTTTACTCGAGTAAAGACTACATCAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201643
UGT1A5 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201643.1-1813s1c1
Sequence:CCGGCTAGTATATGTGATGTGCTTTCTCGAGAAAGCACATCACATATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-269s1c1
Sequence:CCGGGCCGTTCCCTATACAAGACAACTCGAGTTGTCTTGTATAGGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-218s1c1
Sequence:CCGGGAGGTGAACATGCGCATCAAACTCGAGTTTGATGCGCATGTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-1595s1c1
Sequence:CCGGCGAGTGAAGAAATCACACAAACTCGAGTTTGTGTGATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201643.1-456s1c1
Sequence:CCGGGCTCCTTTGATGTAGTCTTTACTCGAGTAAAGACTACATCAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks