EMAIL THIS PAGE TO A FRIEND

UGT1A6

UDP glucuronosyltransferase 1 family, polypeptide A6

Synonyms: GNT1 HLUGP HLUGP1 UDPGT UDPGT 1-6 UGT1 UGT1A6S UGT1F
UniProtKB ID: P19224, A6NKK6, Q96TE7
Gene ID:
Human(54578) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenolic and planar compounds. Alternative splicing in the unique 5' end of this gene results in two transcript variants. [provided by RefSeq, Jul 2008]
Rat(113992) UDP glucuronosyltransferase 1 family, polypeptide A6
Zebrafish(100384896) UDP glucuronosyltransferase 1 family, polypeptide A6
domestic cat(100750222) UDP-glucuronosyltransferase 1A6
dog(403629) UDP glucuronosyltransferase 1 family, polypeptide A6
cow(286792) UDP glucuronosyltransferase 1 family, polypeptide A6
sheep(100534643) UDP glucuronosyltransferase 1 family, polypeptide A6
domestic guinea pig(100731122) UDP glucuronosyltransferase 1 family, polypeptide A6
naked mole-rat(101707823) UDP glucuronosyltransferase 1 family, polypeptide A6
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001072 Rosetta Predictions human pricing
NM_205862 Rosetta Predictions human pricing
NM_001039691 Rosetta Predictions rat pricing
NM_057105 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182322 predicted 2217
2 SASI_Hs01_00182323 predicted 1796
3 SASI_Hs01_00182325 predicted 2130
4 SASI_Hs02_00311903 predicted 2040
5 SASI_Hs01_00182326 predicted 1659
6 SASI_Hs01_00182327 predicted 2128
7 SASI_Hs01_00182328 predicted 2222
8 SASI_Hs01_00182329 predicted 2146
9 SASI_Hs01_00182331 predicted 2207
10 SASI_Hs02_00311904 predicted 1715
11 SASI_Hs01_00182324 predicted 1662
12 SASI_Hs01_00182330 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225595 predicted 1427
2 SASI_Hs01_00225596 predicted 1006
3 SASI_Hs01_00225598 predicted 1344
4 SASI_Hs02_00373504 predicted 1246
5 SASI_Hs01_00225599 predicted 868
6 SASI_Hs01_00225600 predicted 1347
7 SASI_Hs01_00225601 predicted 1429
8 SASI_Hs01_00225602 predicted 1355
9 SASI_Hs01_00225604 predicted 1419
10 SASI_Hs02_00373505 predicted 928
11 SASI_Hs01_00225597 predicted 915
12 SASI_Hs01_00225603 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084403 predicted 1565
2 SASI_Rn01_00084404 predicted 1541
3 SASI_Rn01_00084405 predicted 1359
4 SASI_Rn01_00084406 predicted 1612
5 SASI_Rn01_00084407 predicted 1483
6 SASI_Rn02_00204870 predicted 1235
7 SASI_Rn02_00204871 predicted 1227
8 SASI_Rn01_00084408 predicted 1236
9 SASI_Rn01_00084409 predicted 1356
10 SASI_Rn02_00204872 predicted 1220
11 SASI_Rn01_00084410 predicted 1345
12 SASI_Rn01_00084411 predicted 2117
13 SASI_Rn01_00084412 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106387 predicted 1529
2 SASI_Rn01_00106388 predicted 1506
3 SASI_Rn01_00106389 predicted 1316
4 SASI_Rn01_00106390 predicted 1579
5 SASI_Rn01_00106391 predicted 1444
6 SASI_Rn02_00267037 predicted 1195
7 SASI_Rn02_00267038 predicted 1193
8 SASI_Rn01_00106392 predicted 1191
9 SASI_Rn01_00106393 predicted 1324
10 SASI_Rn02_00267039 predicted 1182
11 SASI_Rn01_00106394 predicted 1310
12 SASI_Rn01_00106395 predicted 2082
13 SASI_Rn01_00106396 predicted 1234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205862
VALIDATED
UGT1A6 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A6
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-198s1c1
Sequence:CCGGGAAAGACTTGTCTCAGGAATTCTCGAGAATTCCTGAGACAAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-186s1c1
Sequence:CCGGCTGTAAGAAGAGGAAAGACTTCTCGAGAAGTCTTTCCTCTTCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_205862.1-929s1c1
Sequence:CCGGCCCACAAATCCAAGACCCATTCTCGAGAATGGGTCTTGGATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-475s1c1
Sequence:CCGGCATGGTGTTTATGAAAGCATACTCGAGTATGCTTTCATAAACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-385s1c1
Sequence:CCGGGCGAACAACACGATACTTGTTCTCGAGAACAAGTATCGTGTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205862.1-1259s21c1
Sequence:CCGGTTGGGAGTGCGGGATTCAAAGCTCGAGCTTTGAATCCCGCACTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-574s21c1
Sequence:CCGGGCTGGAGTGACCCTGAATGTTCTCGAGAACATTCAGGGTCACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-550s21c1
Sequence:CCGGGCAAAGCGCATGGAGACTAAGCTCGAGCTTAGTCTCCATGCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-652s21c1
Sequence:CCGGAGTTACAAGGAGAACATCATGCTCGAGCATGATGTTCTCCTTGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-295s21c1
Sequence:CCGGGAGAAGAAAGCTATGGCAATTCTCGAGAATTGCCATAGCTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-601s21c1
Sequence:CCGGATGACTTCTGAAGATTTAGAACTCGAGTTCTAAATCTTCAGAAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-852s21c1
Sequence:CCGGAGTGGCCTTCATCACCTTTAACTCGAGTTAAAGGTGATGAAGGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205862.1-1342s21c1
Sequence:CCGGATGGTTGCAATTGATCCTTAACTCGAGTTAAGGATCAATTGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-425s21c1
Sequence:CCGGATCTGCTTGGTCACCCGATGACTCGAGTCATCGGGTGACCAAGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205862
VALIDATED
UGT1A6 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A6
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-198s1c1
Sequence:CCGGGAAAGACTTGTCTCAGGAATTCTCGAGAATTCCTGAGACAAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-186s1c1
Sequence:CCGGCTGTAAGAAGAGGAAAGACTTCTCGAGAAGTCTTTCCTCTTCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_205862.1-929s1c1
Sequence:CCGGCCCACAAATCCAAGACCCATTCTCGAGAATGGGTCTTGGATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-475s1c1
Sequence:CCGGCATGGTGTTTATGAAAGCATACTCGAGTATGCTTTCATAAACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-385s1c1
Sequence:CCGGGCGAACAACACGATACTTGTTCTCGAGAACAAGTATCGTGTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205862.1-1259s21c1
Sequence:CCGGTTGGGAGTGCGGGATTCAAAGCTCGAGCTTTGAATCCCGCACTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-574s21c1
Sequence:CCGGGCTGGAGTGACCCTGAATGTTCTCGAGAACATTCAGGGTCACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-550s21c1
Sequence:CCGGGCAAAGCGCATGGAGACTAAGCTCGAGCTTAGTCTCCATGCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-652s21c1
Sequence:CCGGAGTTACAAGGAGAACATCATGCTCGAGCATGATGTTCTCCTTGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-295s21c1
Sequence:CCGGGAGAAGAAAGCTATGGCAATTCTCGAGAATTGCCATAGCTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-601s21c1
Sequence:CCGGATGACTTCTGAAGATTTAGAACTCGAGTTCTAAATCTTCAGAAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-852s21c1
Sequence:CCGGAGTGGCCTTCATCACCTTTAACTCGAGTTAAAGGTGATGAAGGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205862.1-1342s21c1
Sequence:CCGGATGGTTGCAATTGATCCTTAACTCGAGTTAAGGATCAATTGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-425s21c1
Sequence:CCGGATCTGCTTGGTCACCCGATGACTCGAGTCATCGGGTGACCAAGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205862
VALIDATED
UGT1A6 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A6
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-198s1c1
Sequence:CCGGGAAAGACTTGTCTCAGGAATTCTCGAGAATTCCTGAGACAAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-186s1c1
Sequence:CCGGCTGTAAGAAGAGGAAAGACTTCTCGAGAAGTCTTTCCTCTTCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_205862.1-929s1c1
Sequence:CCGGCCCACAAATCCAAGACCCATTCTCGAGAATGGGTCTTGGATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-475s1c1
Sequence:CCGGCATGGTGTTTATGAAAGCATACTCGAGTATGCTTTCATAAACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205862.1-385s1c1
Sequence:CCGGGCGAACAACACGATACTTGTTCTCGAGAACAAGTATCGTGTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205862.1-1259s21c1
Sequence:CCGGTTGGGAGTGCGGGATTCAAAGCTCGAGCTTTGAATCCCGCACTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-574s21c1
Sequence:CCGGGCTGGAGTGACCCTGAATGTTCTCGAGAACATTCAGGGTCACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-550s21c1
Sequence:CCGGGCAAAGCGCATGGAGACTAAGCTCGAGCTTAGTCTCCATGCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-652s21c1
Sequence:CCGGAGTTACAAGGAGAACATCATGCTCGAGCATGATGTTCTCCTTGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-295s21c1
Sequence:CCGGGAGAAGAAAGCTATGGCAATTCTCGAGAATTGCCATAGCTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-601s21c1
Sequence:CCGGATGACTTCTGAAGATTTAGAACTCGAGTTCTAAATCTTCAGAAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-852s21c1
Sequence:CCGGAGTGGCCTTCATCACCTTTAACTCGAGTTAAAGGTGATGAAGGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205862.1-1342s21c1
Sequence:CCGGATGGTTGCAATTGATCCTTAACTCGAGTTAAGGATCAATTGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205862.1-425s21c1
Sequence:CCGGATCTGCTTGGTCACCCGATGACTCGAGTCATCGGGTGACCAAGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks