EMAIL THIS PAGE TO A FRIEND

UGT1A7

UDP glucuronosyltransferase 1 family, polypeptide A7

Synonyms: UDPGT UDPGT 1-7 UGT-1G UGT1-07 UGT1.7 UGT1G
Species: Human UGT1A7(54577), Domestic Rabbit UGT1A7(100037707), Zebrafish ugt1a7(100384891)
UniProtKB ID: Q9HAW7, O00473
Gene ID:
Human(54577) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has moderate glucuronidase activity with phenols. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100037707) UDP glucuronosyltransferase 1 family, polypeptide A7
Zebrafish(100384891) UDP glucuronosyltransferase 1 family, polypeptide A7
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019077 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019077 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136230 predicted 2067
2 SASI_Hs01_00136231 predicted 1656
3 SASI_Hs01_00136233 predicted 1986
4 SASI_Hs02_00352672 predicted 1896
5 SASI_Hs01_00136234 predicted 1516
6 SASI_Hs01_00136235 predicted 1986
7 SASI_Hs01_00136236 predicted 2071
8 SASI_Hs01_00136237 predicted 1997
9 SASI_Hs01_00136239 predicted 2066
10 SASI_Hs02_00352673 predicted 1567
11 SASI_Hs01_00136232 predicted 1557
12 SASI_Hs01_00136238 predicted 1510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019077
VALIDATED
UGT1A7 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019077.2-679s1c1
Sequence:CCGGGTCTTAGAAATAGCCTCTGAACTCGAGTTCAGAGGCTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019077.2-222s1c1
Sequence:CCGGGAAGACTTACTCAACCTCATACTCGAGTATGAGGTTGAGTAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019077.2-854s21c1
Sequence:CCGGTGGAATTTGAAGCCTACATTACTCGAGTAATGTAGGCTTCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-298s21c1
Sequence:CCGGGCACCATTGCGAAGTGCATTTCTCGAGAAATGCACTTCGCAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-1448s21c1
Sequence:CCGGACCATTCCTTGGACGTGATTGCTCGAGCAATCACGTCCAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019077.2-1520s21c1
Sequence:CCGGGTGCTTATGGCTACCGGAAATCTCGAGATTTCCGGTAGCCATAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019077.2-1622s21c1
Sequence:CCGGTGAACCATTCCCTAGTCATTTCTCGAGAAATGACTAGGGAATGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-328s21c1
Sequence:CCGGACAAGTTCATCCAATGGTATTCTCGAGAATACCATTGGATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019077
VALIDATED
UGT1A7 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019077.2-679s1c1
Sequence:CCGGGTCTTAGAAATAGCCTCTGAACTCGAGTTCAGAGGCTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019077.2-222s1c1
Sequence:CCGGGAAGACTTACTCAACCTCATACTCGAGTATGAGGTTGAGTAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019077.2-854s21c1
Sequence:CCGGTGGAATTTGAAGCCTACATTACTCGAGTAATGTAGGCTTCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-298s21c1
Sequence:CCGGGCACCATTGCGAAGTGCATTTCTCGAGAAATGCACTTCGCAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-1448s21c1
Sequence:CCGGACCATTCCTTGGACGTGATTGCTCGAGCAATCACGTCCAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019077.2-1520s21c1
Sequence:CCGGGTGCTTATGGCTACCGGAAATCTCGAGATTTCCGGTAGCCATAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019077.2-1622s21c1
Sequence:CCGGTGAACCATTCCCTAGTCATTTCTCGAGAAATGACTAGGGAATGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-328s21c1
Sequence:CCGGACAAGTTCATCCAATGGTATTCTCGAGAATACCATTGGATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019077
VALIDATED
UGT1A7 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019077.2-679s1c1
Sequence:CCGGGTCTTAGAAATAGCCTCTGAACTCGAGTTCAGAGGCTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019077.2-222s1c1
Sequence:CCGGGAAGACTTACTCAACCTCATACTCGAGTATGAGGTTGAGTAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019077.2-854s21c1
Sequence:CCGGTGGAATTTGAAGCCTACATTACTCGAGTAATGTAGGCTTCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-298s21c1
Sequence:CCGGGCACCATTGCGAAGTGCATTTCTCGAGAAATGCACTTCGCAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-1448s21c1
Sequence:CCGGACCATTCCTTGGACGTGATTGCTCGAGCAATCACGTCCAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019077.2-1520s21c1
Sequence:CCGGGTGCTTATGGCTACCGGAAATCTCGAGATTTCCGGTAGCCATAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019077.2-1622s21c1
Sequence:CCGGTGAACCATTCCCTAGTCATTTCTCGAGAAATGACTAGGGAATGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019077.2-328s21c1
Sequence:CCGGACAAGTTCATCCAATGGTATTCTCGAGAATACCATTGGATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks