EMAIL THIS PAGE TO A FRIEND

UGT1A8

UDP glucuronosyltransferase 1 family, polypeptide A8

Synonyms: UDPGT UDPGT 1-8 UGT-1H UGT1-08 UGT1.8 UGT1A8S UGT1H
UniProtKB ID: Q9HAW9, B2R8S3, O14928, Q8TEX4, Q8WTQ9, Q8WX85
Gene ID:
Human(54576) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity with many substrates including coumarins, phenols, anthraquinones, flavones, and some opioids. [provided by RefSeq, Jul 2008]
Mouse(613123) UDP glucuronosyltransferase 1 family, polypeptide A8
Rat(301595) UDP glycosyltransferase 1 family, polypeptide A8
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019076 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019076 Rosetta Predictions human pricing
NM_175846 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101595 predicted 2128
2 SASI_Hs01_00101596 predicted 1716
3 SASI_Hs01_00101598 predicted 2049
4 SASI_Hs02_00352670 predicted 1958
5 SASI_Hs01_00101599 predicted 1576
6 SASI_Hs01_00101600 predicted 2049
7 SASI_Hs01_00101601 predicted 2134
8 SASI_Hs01_00101602 predicted 2068
9 SASI_Hs01_00101604 predicted 2123
10 SASI_Hs02_00352671 predicted 1631
11 SASI_Hs01_00101597 predicted 1625
12 SASI_Hs01_00101603 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044017 predicted 1445
2 SASI_Rn01_00044018 predicted 1426
3 SASI_Rn01_00044019 predicted 1236
4 SASI_Rn01_00044020 predicted 1488
5 SASI_Rn01_00044021 predicted 1361
6 SASI_Rn02_00269550 predicted 1113
7 SASI_Rn02_00269551 predicted 1106
8 SASI_Rn01_00044022 predicted 1113
9 SASI_Rn01_00044023 predicted 1230
10 SASI_Rn02_00269552 predicted 1094
11 SASI_Rn01_00044024 predicted 1230
12 SASI_Rn01_00044025 predicted 1999
13 SASI_Rn01_00044026 predicted 1154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019076
UGT1A8 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-361s1c1
Sequence:CCGGGCACAAGTACGAAGTTTGTTTCTCGAGAAACAAACTTCGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-96s1c1
Sequence:CCGGCCTATGTGTTTCTCTGCTGCTCTCGAGAGCAGCAGAGAAACACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-384s1c1
Sequence:CCGGTCTATTTCTGAGTTCATCCAACTCGAGTTGGATGAACTCAGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-580s1c1
Sequence:CCGGGCTTGCCACTATCTTGAAGAACTCGAGTTCTTCAAGATAGTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-278s1c1
Sequence:CCGGGCACAGTGAAGACTTACTCAACTCGAGTTGAGTAAGTCTTCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-336s21c1
Sequence:CCGGGGATTTCGCCGATGCTCAATGCTCGAGCATTGAGCATCGGCGAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-492s21c1
Sequence:CCGGTGCGGTGTTTCTTGATCCTTTCTCGAGAAAGGATCAAGAAACACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-918s21c1
Sequence:CCGGGGAATTTGAAGCCTACATTAACTCGAGTTAATGTAGGCTTCAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019076.4-1660s21c1
Sequence:CCGGGTGGGTGGGAAATAAGGTAAACTCGAGTTTACCTTATTTCCCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-189s21c1
Sequence:CCGGGTCGGTGGTGGAGAAACTTATCTCGAGATAAGTTTCTCCACCACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019076
UGT1A8 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-361s1c1
Sequence:CCGGGCACAAGTACGAAGTTTGTTTCTCGAGAAACAAACTTCGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-96s1c1
Sequence:CCGGCCTATGTGTTTCTCTGCTGCTCTCGAGAGCAGCAGAGAAACACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-384s1c1
Sequence:CCGGTCTATTTCTGAGTTCATCCAACTCGAGTTGGATGAACTCAGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-580s1c1
Sequence:CCGGGCTTGCCACTATCTTGAAGAACTCGAGTTCTTCAAGATAGTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-278s1c1
Sequence:CCGGGCACAGTGAAGACTTACTCAACTCGAGTTGAGTAAGTCTTCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-336s21c1
Sequence:CCGGGGATTTCGCCGATGCTCAATGCTCGAGCATTGAGCATCGGCGAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-492s21c1
Sequence:CCGGTGCGGTGTTTCTTGATCCTTTCTCGAGAAAGGATCAAGAAACACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-918s21c1
Sequence:CCGGGGAATTTGAAGCCTACATTAACTCGAGTTAATGTAGGCTTCAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019076.4-1660s21c1
Sequence:CCGGGTGGGTGGGAAATAAGGTAAACTCGAGTTTACCTTATTTCCCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-189s21c1
Sequence:CCGGGTCGGTGGTGGAGAAACTTATCTCGAGATAAGTTTCTCCACCACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019076
UGT1A8 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-361s1c1
Sequence:CCGGGCACAAGTACGAAGTTTGTTTCTCGAGAAACAAACTTCGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-96s1c1
Sequence:CCGGCCTATGTGTTTCTCTGCTGCTCTCGAGAGCAGCAGAGAAACACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-384s1c1
Sequence:CCGGTCTATTTCTGAGTTCATCCAACTCGAGTTGGATGAACTCAGAAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-580s1c1
Sequence:CCGGGCTTGCCACTATCTTGAAGAACTCGAGTTCTTCAAGATAGTGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019076.4-278s1c1
Sequence:CCGGGCACAGTGAAGACTTACTCAACTCGAGTTGAGTAAGTCTTCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-336s21c1
Sequence:CCGGGGATTTCGCCGATGCTCAATGCTCGAGCATTGAGCATCGGCGAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-492s21c1
Sequence:CCGGTGCGGTGTTTCTTGATCCTTTCTCGAGAAAGGATCAAGAAACACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-918s21c1
Sequence:CCGGGGAATTTGAAGCCTACATTAACTCGAGTTAATGTAGGCTTCAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019076.4-1660s21c1
Sequence:CCGGGTGGGTGGGAAATAAGGTAAACTCGAGTTTACCTTATTTCCCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019076.4-189s21c1
Sequence:CCGGGTCGGTGGTGGAGAAACTTATCTCGAGATAAGTTTCTCCACCACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks