EMAIL THIS PAGE TO A FRIEND

UGT1A9

UDP glucuronosyltransferase 1 family, polypeptide A9

Synonyms: HLUGP4 LUGP4 UDPGT UDPGT 1-9 UGT-1I UGT1-09 UGT1-9 UGT1.9 UGT1AI UGT1I
UniProtKB ID: O60656, P36509, Q9HAX0
Gene ID:
Human(54600) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenols. [provided by RefSeq, Jul 2008]
Mouse(394434) UDP glucuronosyltransferase 1 family, polypeptide A9
Rat(396552) UDP glucuronosyltransferase 1 family, polypeptide A9
chicken(771048) UDP glucuronosyltransferase 1 family, polypeptide A9
sheep(442993) UDP glucuronosyltransferase 1 family, polypeptide A9
domestic guinea pig(100721353) UDP glucuronosyltransferase 1 family, polypeptide A9
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223211 MISSION® esiRNA esiRNA targeting human UGT1A9 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021027 Rosetta Predictions human pricing
NM_201425 Rosetta Predictions rat pricing
NM_201644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014110 predicted 2106
2 SASI_Hs01_00014111 predicted 1690
3 SASI_Hs01_00014113 predicted 2023
4 SASI_Hs02_00354502 predicted 1924
5 SASI_Hs01_00014114 predicted 1549
6 SASI_Hs01_00014115 predicted 2020
7 SASI_Hs01_00014116 predicted 2111
8 SASI_Hs01_00014117 predicted 2038
9 SASI_Hs01_00014119 predicted 2098
10 SASI_Hs02_00354503 predicted 1601
11 SASI_Hs01_00014112 predicted 1600
12 SASI_Hs01_00014118 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105623 predicted 1445
2 SASI_Rn01_00105624 predicted 1421
3 SASI_Rn01_00105625 predicted 1237
4 SASI_Rn01_00105626 predicted 1491
5 SASI_Rn01_00105627 predicted 1361
6 SASI_Rn02_00270326 predicted 1110
7 SASI_Rn02_00270327 predicted 1111
8 SASI_Rn01_00105628 predicted 1115
9 SASI_Rn01_00105629 predicted 1235
10 SASI_Rn02_00270328 predicted 1097
11 SASI_Rn01_00105630 predicted 1232
12 SASI_Rn01_00105631 predicted 1995
13 SASI_Rn01_00105632 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351740 predicted 1337
2 SASI_Mm01_00133238 predicted 1159
3 SASI_Mm02_00351741 predicted 1396
4 SASI_Mm01_00133240 predicted 1155
5 SASI_Mm02_00351742 predicted 1369
6 SASI_Mm02_00351743 predicted 1271
7 SASI_Mm02_00351744 predicted 1178
8 SASI_Mm02_00351745 predicted 1181
9 SASI_Mm02_00351746 predicted 1163
10 SASI_Mm02_00351747 predicted 1223
11 SASI_Mm01_00133232 predicted 1854
12 SASI_Mm01_00133233 predicted 1840
13 SASI_Mm01_00133234 predicted 1921
14 SASI_Mm01_00133235 predicted 1877
15 SASI_Mm01_00133236 predicted 1797
16 SASI_Mm01_00133237 predicted 1877
17 SASI_Mm01_00133239 predicted 1164
18 SASI_Mm01_00133241 predicted 1867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021027
UGT1A9 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021027.2-743s21c1
Sequence:CCGGCAAACACCTGTTACGGAGTATCTCGAGATACTCCGTAACAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021027.2-409s21c1
Sequence:CCGGCAGGAGTTTGTTTAAAGACAACTCGAGTTGTCTTTAAACAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-717s1c1
Sequence:CCGGCCCTAGAAATAGCCTCTGAAACTCGAGTTTCAGAGGCTATTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-881s1c1
Sequence:CCGGCCGTTGCCTATGGAATTTGAACTCGAGTTCAAATTCCATAGGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-272s1c1
Sequence:CCGGACTTCATATACCCTGGAGGATCTCGAGATCCTCCAGGGTATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-685s1c1
Sequence:CCGGACATTTATTATGCCACCGTTTCTCGAGAAACGGTGGCATAATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-335s1c1
Sequence:CCGGGCACAAGTACGAAGTATATATCTCGAGATATATACTTCGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021027
UGT1A9 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021027.2-743s21c1
Sequence:CCGGCAAACACCTGTTACGGAGTATCTCGAGATACTCCGTAACAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021027.2-409s21c1
Sequence:CCGGCAGGAGTTTGTTTAAAGACAACTCGAGTTGTCTTTAAACAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-717s1c1
Sequence:CCGGCCCTAGAAATAGCCTCTGAAACTCGAGTTTCAGAGGCTATTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-881s1c1
Sequence:CCGGCCGTTGCCTATGGAATTTGAACTCGAGTTCAAATTCCATAGGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-272s1c1
Sequence:CCGGACTTCATATACCCTGGAGGATCTCGAGATCCTCCAGGGTATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-685s1c1
Sequence:CCGGACATTTATTATGCCACCGTTTCTCGAGAAACGGTGGCATAATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-335s1c1
Sequence:CCGGGCACAAGTACGAAGTATATATCTCGAGATATATACTTCGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021027
UGT1A9 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021027.2-743s21c1
Sequence:CCGGCAAACACCTGTTACGGAGTATCTCGAGATACTCCGTAACAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021027.2-409s21c1
Sequence:CCGGCAGGAGTTTGTTTAAAGACAACTCGAGTTGTCTTTAAACAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-717s1c1
Sequence:CCGGCCCTAGAAATAGCCTCTGAAACTCGAGTTTCAGAGGCTATTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-881s1c1
Sequence:CCGGCCGTTGCCTATGGAATTTGAACTCGAGTTCAAATTCCATAGGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-272s1c1
Sequence:CCGGACTTCATATACCCTGGAGGATCTCGAGATCCTCCAGGGTATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-685s1c1
Sequence:CCGGACATTTATTATGCCACCGTTTCTCGAGAAACGGTGGCATAATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021027.2-335s1c1
Sequence:CCGGGCACAAGTACGAAGTATATATCTCGAGATATATACTTCGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201644
UGT1A9 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201644.1-1965s1c1
Sequence:CCGGCCTTCTCCAGTGTTAGTCATTCTCGAGAATGACTAACACTGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-646s1c1
Sequence:CCGGTGGAACCATCTTATCTACATTCTCGAGAATGTAGATAAGATGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-1351s1c1
Sequence:CCGGCTTCACAAGGACCGTCCTATACTCGAGTATAGGACGGTCCTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-482s1c1
Sequence:CCGGGTGGATTAATTGTCGCCAAATCTCGAGATTTGGCGACAATTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-1261s1c1
Sequence:CCGGCTTGAAATGACTGCTGATGATCTCGAGATCATCAGCAGTCATTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201644
UGT1A9 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201644.1-1965s1c1
Sequence:CCGGCCTTCTCCAGTGTTAGTCATTCTCGAGAATGACTAACACTGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-646s1c1
Sequence:CCGGTGGAACCATCTTATCTACATTCTCGAGAATGTAGATAAGATGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-1351s1c1
Sequence:CCGGCTTCACAAGGACCGTCCTATACTCGAGTATAGGACGGTCCTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-482s1c1
Sequence:CCGGGTGGATTAATTGTCGCCAAATCTCGAGATTTGGCGACAATTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-1261s1c1
Sequence:CCGGCTTGAAATGACTGCTGATGATCTCGAGATCATCAGCAGTCATTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201644
UGT1A9 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201644.1-1965s1c1
Sequence:CCGGCCTTCTCCAGTGTTAGTCATTCTCGAGAATGACTAACACTGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-646s1c1
Sequence:CCGGTGGAACCATCTTATCTACATTCTCGAGAATGTAGATAAGATGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-1351s1c1
Sequence:CCGGCTTCACAAGGACCGTCCTATACTCGAGTATAGGACGGTCCTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-482s1c1
Sequence:CCGGGTGGATTAATTGTCGCCAAATCTCGAGATTTGGCGACAATTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201644.1-1261s1c1
Sequence:CCGGCTTGAAATGACTGCTGATGATCTCGAGATCATCAGCAGTCATTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks