EMAIL THIS PAGE TO A FRIEND

UGT2A1

UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus

UniProtKB ID: Q9Y4X1, B4E2F4, D3GER1, D3GER2, E9PDM7, J3KNA3
Gene ID:
Human(10941) Summary: The protein encoded by this gene belongs to the UDP-glycosyltransferase family, members of which catalyze biotransformation reactions in which lipophilic substrates are conjugated with glucuronic acid to increase water solubility and enhance excretion. They are of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This enzyme is expressed in the olfactory neuroepithelium, which lines the posterior nasal cavity and is exposed to a wide range of odorants and airborne toxic compounds. Hence, this protein has been suggested to be involved in clearing lipophilic odorant molecules from the sensory epithelium. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(94215) UDP glucuronosyltransferase 2 family, polypeptide A1
Rat(63867) UDP glucuronosyltransferase 2 family, polypeptide A1
Zebrafish(100006320) UDP glucuronosyltransferase 2 family, polypeptide A1
sheep(101119640) UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
domestic guinea pig(100717542) UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
naked mole-rat(101713955) UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301197 ANTI-UD2A1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB1301546 ANTI-UD2A1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006798 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046041 MISSION® esiRNA esiRNA human UGT2A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006798 Rosetta Predictions human pricing
NM_022228 Rosetta Predictions rat pricing
NM_053184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342312 predicted 1231
2 SASI_Hs01_00029720 predicted 1165
3 SASI_Hs01_00029721 predicted 1305
4 SASI_Hs01_00029723 predicted 1231
5 SASI_Hs01_00029727 predicted 1344
6 SASI_Hs02_00342313 predicted 1105
7 SASI_Hs02_00342314 predicted 1304
8 SASI_Hs02_00342315 predicted 1085
9 SASI_Hs02_00342316 predicted 1358
10 SASI_Hs02_00342317 predicted 736
11 SASI_Hs01_00029722 predicted 819
12 SASI_Hs01_00029724 predicted 690
13 SASI_Hs01_00029725 predicted 364
14 SASI_Hs01_00029726 predicted 320
15 SASI_Hs01_00029728 predicted 307
16 SASI_Hs01_00029729 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040212 predicted 795
2 SASI_Rn01_00040213 predicted 246
3 SASI_Rn01_00040214 predicted 450
4 SASI_Rn01_00040215 predicted 1124
5 SASI_Rn01_00040216 predicted 1194
6 SASI_Rn01_00040217 predicted 688
7 SASI_Rn01_00040218 predicted 1035
8 SASI_Rn01_00040219 predicted 1058
9 SASI_Rn01_00040220 predicted 421
10 SASI_Rn01_00040221 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337740 predicted 1206
2 SASI_Mm01_00092757 predicted 1371
3 SASI_Mm02_00337741 predicted 1578
4 SASI_Mm01_00092759 predicted 1104
5 SASI_Mm01_00092760 predicted 1118
6 SASI_Mm02_00337742 predicted 1586
7 SASI_Mm01_00092761 predicted 1274
8 SASI_Mm02_00337743 predicted 1704
9 SASI_Mm01_00092762 predicted 1335
10 SASI_Mm01_00092764 predicted 1341
11 SASI_Mm01_00092758 predicted 1314
12 SASI_Mm01_00092763 predicted 1106
13 SASI_Mm01_00092765 predicted 1190
14 SASI_Mm01_00092766 predicted 1112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006798
UGT2A1 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000036339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-856s1c1
Sequence:CCGGCCTCGTCCATACTTACCTAATCTCGAGATTAGGTAAGTATGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-527s1c1
Sequence:CCGGGTGGCGATATAGTAGCTTTAACTCGAGTTAAAGCTACTATATCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-1311s1c1
Sequence:CCGGCACAATGACAAGTGTGGATTTCTCGAGAAATCCACACTTGTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-146s1c1
Sequence:CCGGTGGAAGGTAGTCATTGGCTAACTCGAGTTAGCCAATGACTACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006798
UGT2A1 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000036339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-856s1c1
Sequence:CCGGCCTCGTCCATACTTACCTAATCTCGAGATTAGGTAAGTATGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-527s1c1
Sequence:CCGGGTGGCGATATAGTAGCTTTAACTCGAGTTAAAGCTACTATATCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-1311s1c1
Sequence:CCGGCACAATGACAAGTGTGGATTTCTCGAGAAATCCACACTTGTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-146s1c1
Sequence:CCGGTGGAAGGTAGTCATTGGCTAACTCGAGTTAGCCAATGACTACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006798
UGT2A1 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000036339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-856s1c1
Sequence:CCGGCCTCGTCCATACTTACCTAATCTCGAGATTAGGTAAGTATGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-527s1c1
Sequence:CCGGGTGGCGATATAGTAGCTTTAACTCGAGTTAAAGCTACTATATCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-1311s1c1
Sequence:CCGGCACAATGACAAGTGTGGATTTCTCGAGAAATCCACACTTGTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006798.1-146s1c1
Sequence:CCGGTGGAAGGTAGTCATTGGCTAACTCGAGTTAGCCAATGACTACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053184
UGT2A1 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-568s1c1
Sequence:CCGGCCTTCCTATGTACCTGCAATTCTCGAGAATTGCAGGTACATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-439s1c1
Sequence:CCGGCTGTTATCAGACCCTGTATTTCTCGAGAAATACAGGGTCTGATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-312s1c1
Sequence:CCGGCTGGACTTTCTATAAGGAAATCTCGAGATTTCCTTATAGAAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-198s1c1
Sequence:CCGGCCCATCTCTGACATTTGAAATCTCGAGATTTCAAATGTCAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-1040s1c1
Sequence:CCGGCCAATACAAGACTGTTTGATTCTCGAGAATCAAACAGTCTTGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053184
UGT2A1 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-568s1c1
Sequence:CCGGCCTTCCTATGTACCTGCAATTCTCGAGAATTGCAGGTACATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-439s1c1
Sequence:CCGGCTGTTATCAGACCCTGTATTTCTCGAGAAATACAGGGTCTGATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-312s1c1
Sequence:CCGGCTGGACTTTCTATAAGGAAATCTCGAGATTTCCTTATAGAAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-198s1c1
Sequence:CCGGCCCATCTCTGACATTTGAAATCTCGAGATTTCAAATGTCAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-1040s1c1
Sequence:CCGGCCAATACAAGACTGTTTGATTCTCGAGAATCAAACAGTCTTGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053184
UGT2A1 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-568s1c1
Sequence:CCGGCCTTCCTATGTACCTGCAATTCTCGAGAATTGCAGGTACATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-439s1c1
Sequence:CCGGCTGTTATCAGACCCTGTATTTCTCGAGAAATACAGGGTCTGATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-312s1c1
Sequence:CCGGCTGGACTTTCTATAAGGAAATCTCGAGATTTCCTTATAGAAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-198s1c1
Sequence:CCGGCCCATCTCTGACATTTGAAATCTCGAGATTTCAAATGTCAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053184.1-1040s1c1
Sequence:CCGGCCAATACAAGACTGTTTGATTCTCGAGAATCAAACAGTCTTGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks