EMAIL THIS PAGE TO A FRIEND

UGT2A2

UDP glucuronosyltransferase 2 family, polypeptide A2

Gene ID:
Mouse(552899) UDP glucuronosyltransferase 2 family, polypeptide A2
Zebrafish(553952) UDP glucuronosyltransferase 2 family, polypeptide A2
dog(475163) UDP glucuronosyltransferase 2 family, polypeptide A2
Horse(100068176) UDP glucuronosyltransferase 2 family, polypeptide A2
domestic cat(101087059) UDP glucuronosyltransferase 2 family, polypeptide A2
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105677 Rosetta Predictions human pricing
NM_001024148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324658 predicted 1168
2 SASI_Hs02_00324659 predicted 1103
3 SASI_Hs02_00324660 predicted 1247
4 SASI_Hs02_00324661 predicted 1171
5 SASI_Hs02_00324662 predicted 1283
6 SASI_Hs02_00324663 predicted 1040
7 SASI_Hs02_00324664 predicted 1244
8 SASI_Hs02_00324665 predicted 1022
9 SASI_Hs02_00324666 predicted 1298
10 SASI_Hs02_00324667 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287566 predicted 1173
2 SASI_Mm01_00046466 predicted 1338
3 SASI_Mm02_00287567 predicted 1556
4 SASI_Mm01_00046468 predicted 1078
5 SASI_Mm01_00046469 predicted 1092
6 SASI_Mm02_00287568 predicted 1557
7 SASI_Mm01_00046472 predicted 1247
8 SASI_Mm02_00287569 predicted 1674
9 SASI_Mm01_00046473 predicted 1304
10 SASI_Mm01_00046475 predicted 1305
11 SASI_Mm01_00046467 predicted 1370
12 SASI_Mm01_00046470 predicted 1331
13 SASI_Mm01_00046471 predicted 1086
14 SASI_Mm01_00046474 predicted 1168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024148
UGT2A2 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-120s1c1
Sequence:CCGGGTGGTAGTTTGGCCTACAGATCTCGAGATCTGTAGGCCAAACTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-697s1c1
Sequence:CCGGCTTATTCTCTGCAAGACTATACTCGAGTATAGTCTTGCAGAGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-423s1c1
Sequence:CCGGCAAATGTGTGATGGTGTACTACTCGAGTAGTACACCATCACACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024148.1-2423s1c1
Sequence:CCGGGCTCTGTGTTCATCCATTATACTCGAGTATAATGGATGAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-399s1c1
Sequence:CCGGGCTACTTTCTACACAACCAATCTCGAGATTGGTTGTGTAGAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024148
UGT2A2 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-120s1c1
Sequence:CCGGGTGGTAGTTTGGCCTACAGATCTCGAGATCTGTAGGCCAAACTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-697s1c1
Sequence:CCGGCTTATTCTCTGCAAGACTATACTCGAGTATAGTCTTGCAGAGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-423s1c1
Sequence:CCGGCAAATGTGTGATGGTGTACTACTCGAGTAGTACACCATCACACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024148.1-2423s1c1
Sequence:CCGGGCTCTGTGTTCATCCATTATACTCGAGTATAATGGATGAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-399s1c1
Sequence:CCGGGCTACTTTCTACACAACCAATCTCGAGATTGGTTGTGTAGAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024148
UGT2A2 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-120s1c1
Sequence:CCGGGTGGTAGTTTGGCCTACAGATCTCGAGATCTGTAGGCCAAACTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-697s1c1
Sequence:CCGGCTTATTCTCTGCAAGACTATACTCGAGTATAGTCTTGCAGAGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-423s1c1
Sequence:CCGGCAAATGTGTGATGGTGTACTACTCGAGTAGTACACCATCACACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024148.1-2423s1c1
Sequence:CCGGGCTCTGTGTTCATCCATTATACTCGAGTATAATGGATGAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024148.1-399s1c1
Sequence:CCGGGCTACTTTCTACACAACCAATCTCGAGATTGGTTGTGTAGAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105677
UGT2A2 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide A2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-375s21c1
Sequence:CCGGACTCTGTGATGGTGTACTAAACTCGAGTTTAGTACACCATCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-162s21c1
Sequence:CCGGGGCTTCATCAGCAACTCTATTCTCGAGAATAGAGTTGCTGATGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-296s21c1
Sequence:CCGGGACCAACTCCTCTCACAATATCTCGAGATATTGTGAGAGGAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-89s21c1
Sequence:CCGGATGGTAGCCATTGGTTAAATACTCGAGTATTTAACCAATGGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-649s21c1
Sequence:CCGGTATTCTCTGCAAGACTATATACTCGAGTATATAGTCTTGCAGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105677
UGT2A2 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide A2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-375s21c1
Sequence:CCGGACTCTGTGATGGTGTACTAAACTCGAGTTTAGTACACCATCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-162s21c1
Sequence:CCGGGGCTTCATCAGCAACTCTATTCTCGAGAATAGAGTTGCTGATGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-296s21c1
Sequence:CCGGGACCAACTCCTCTCACAATATCTCGAGATATTGTGAGAGGAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-89s21c1
Sequence:CCGGATGGTAGCCATTGGTTAAATACTCGAGTATTTAACCAATGGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-649s21c1
Sequence:CCGGTATTCTCTGCAAGACTATATACTCGAGTATATAGTCTTGCAGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105677
UGT2A2 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide A2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-375s21c1
Sequence:CCGGACTCTGTGATGGTGTACTAAACTCGAGTTTAGTACACCATCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-162s21c1
Sequence:CCGGGGCTTCATCAGCAACTCTATTCTCGAGAATAGAGTTGCTGATGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-296s21c1
Sequence:CCGGGACCAACTCCTCTCACAATATCTCGAGATATTGTGAGAGGAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-89s21c1
Sequence:CCGGATGGTAGCCATTGGTTAAATACTCGAGTATTTAACCAATGGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105677.1-649s21c1
Sequence:CCGGTATTCTCTGCAAGACTATATACTCGAGTATATAGTCTTGCAGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks