EMAIL THIS PAGE TO A FRIEND

UGT2A3

UDP glucuronosyltransferase 2 family, polypeptide A3

UniProtKB ID: Q6UWM9, Q9H6S4
Gene ID:
Mouse(72094) UDP glucuronosyltransferase 2 family, polypeptide A3
Rat(289533) UDP glucuronosyltransferase 2 family, polypeptide A3
Zebrafish(100384900) UDP glucuronosyltransferase 2 family, polypeptide A3
chicken(422660) UDP glucuronosyltransferase 2 family, polypeptide A3
cow(511743) UDP glucuronosyltransferase 2 family, polypeptide A3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024743 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110201 MISSION® esiRNA esiRNA human UGT2A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024743 Rosetta Predictions human pricing
XM_001074267 Rosetta Predictions rat pricing
XM_223289 Rosetta Predictions rat pricing
NM_028094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357225 predicted 1310
2 SASI_Hs01_00225615 predicted 779
3 SASI_Hs01_00225617 predicted 734
4 SASI_Hs01_00225618 predicted 1020
5 SASI_Hs01_00225619 predicted 1286
6 SASI_Hs01_00225620 predicted 1271
7 SASI_Hs01_00225621 predicted 248
8 SASI_Hs01_00225622 predicted 324
9 SASI_Hs01_00225623 predicted 1277
10 SASI_Hs01_00225624 predicted 437
11 SASI_Hs01_00225616 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345631 predicted 1178
2 SASI_Rn02_00345632 predicted 862
3 SASI_Rn02_00345633 predicted 609
4 SASI_Rn02_00345634 predicted 321
5 SASI_Rn02_00345635 predicted 776
6 SASI_Rn02_00345636 predicted 324
7 SASI_Rn02_00345637 predicted 1264
8 SASI_Rn02_00345638 predicted 778
9 SASI_Rn02_00345639 predicted 213
10 SASI_Rn02_00345640 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193355 predicted 321
2 SASI_Rn01_00193356 predicted 327
3 SASI_Rn01_00193357 predicted 246
4 SASI_Rn01_00193359 predicted 242
5 SASI_Rn01_00193360 predicted 221
6 SASI_Rn02_00381239 predicted 225
7 SASI_Rn01_00193362 predicted 261
8 SASI_Rn01_00193363 predicted 247
9 SASI_Rn01_00193364 predicted 319
10 SASI_Rn02_00381240 predicted 319
11 SASI_Rn01_00193358 predicted 248
12 SASI_Rn01_00193361 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100078 predicted 1140
2 SASI_Mm01_00100079 predicted 1498
3 SASI_Mm01_00100080 predicted 418
4 SASI_Mm01_00100081 predicted 1510
5 SASI_Mm01_00100082 predicted 1028
6 SASI_Mm01_00100083 predicted 562
7 SASI_Mm02_00333340 predicted 1203
8 SASI_Mm01_00100084 predicted 209
9 SASI_Mm01_00100085 predicted 772
10 SASI_Mm01_00100086 predicted 335
11 SASI_Mm01_00100087 predicted 561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024743
UGT2A3 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide A3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-203s21c1
Sequence:CCGGCACTCAAAGCCTTCGTTAATTCTCGAGAATTAACGAAGGCTTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-1280s21c1
Sequence:CCGGACTATGACAAGCGAAGATTTACTCGAGTAAATCTTCGCTTGTCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-1015s21c1
Sequence:CCGGGATCCCACAGAAGGTGTTATGCTCGAGCATAACACCTTCTGTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-334s21c1
Sequence:CCGGATCAACCTGGCAATCAGTTATCTCGAGATAACTGATTGCCAGGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024743.3-1752s21c1
Sequence:CCGGTCATGAGGTTGTGAGTATATCCTCGAGGATATACTCACAACCTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024743.2-1285s1c1
Sequence:CCGGGCGAAGATTTACTGAGGGCTTCTCGAGAAGCCCTCAGTAAATCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024743.2-1660s1c1
Sequence:CCGGGCCACATAGAATTTGGTGAAACTCGAGTTTCACCAAATTCTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-822s1c1
Sequence:CCGGCAACCATACCAACCTAACTTTCTCGAGAAAGTTAGGTTGGTATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-778s1c1
Sequence:CCGGCTGAGATATGGCTAATACGAACTCGAGTTCGTATTAGCCATATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-448s1c1
Sequence:CCGGCCAACTACGATGTAATGCTTACTCGAGTAAGCATTACATCGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024743
UGT2A3 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide A3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-203s21c1
Sequence:CCGGCACTCAAAGCCTTCGTTAATTCTCGAGAATTAACGAAGGCTTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-1280s21c1
Sequence:CCGGACTATGACAAGCGAAGATTTACTCGAGTAAATCTTCGCTTGTCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-1015s21c1
Sequence:CCGGGATCCCACAGAAGGTGTTATGCTCGAGCATAACACCTTCTGTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-334s21c1
Sequence:CCGGATCAACCTGGCAATCAGTTATCTCGAGATAACTGATTGCCAGGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024743.3-1752s21c1
Sequence:CCGGTCATGAGGTTGTGAGTATATCCTCGAGGATATACTCACAACCTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024743.2-1285s1c1
Sequence:CCGGGCGAAGATTTACTGAGGGCTTCTCGAGAAGCCCTCAGTAAATCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024743.2-1660s1c1
Sequence:CCGGGCCACATAGAATTTGGTGAAACTCGAGTTTCACCAAATTCTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-822s1c1
Sequence:CCGGCAACCATACCAACCTAACTTTCTCGAGAAAGTTAGGTTGGTATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-778s1c1
Sequence:CCGGCTGAGATATGGCTAATACGAACTCGAGTTCGTATTAGCCATATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-448s1c1
Sequence:CCGGCCAACTACGATGTAATGCTTACTCGAGTAAGCATTACATCGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024743
UGT2A3 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide A3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-203s21c1
Sequence:CCGGCACTCAAAGCCTTCGTTAATTCTCGAGAATTAACGAAGGCTTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-1280s21c1
Sequence:CCGGACTATGACAAGCGAAGATTTACTCGAGTAAATCTTCGCTTGTCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-1015s21c1
Sequence:CCGGGATCCCACAGAAGGTGTTATGCTCGAGCATAACACCTTCTGTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024743.3-334s21c1
Sequence:CCGGATCAACCTGGCAATCAGTTATCTCGAGATAACTGATTGCCAGGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024743.3-1752s21c1
Sequence:CCGGTCATGAGGTTGTGAGTATATCCTCGAGGATATACTCACAACCTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024743.2-1285s1c1
Sequence:CCGGGCGAAGATTTACTGAGGGCTTCTCGAGAAGCCCTCAGTAAATCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024743.2-1660s1c1
Sequence:CCGGGCCACATAGAATTTGGTGAAACTCGAGTTTCACCAAATTCTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-822s1c1
Sequence:CCGGCAACCATACCAACCTAACTTTCTCGAGAAAGTTAGGTTGGTATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-778s1c1
Sequence:CCGGCTGAGATATGGCTAATACGAACTCGAGTTCGTATTAGCCATATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024743.2-448s1c1
Sequence:CCGGCCAACTACGATGTAATGCTTACTCGAGTAAGCATTACATCGTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028094
UGT2A3 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide A3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028094.1-1719s1c1
Sequence:CCGGGCTCTGTTTCAGACTGGAAATCTCGAGATTTCCAGTCTGAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-1148s1c1
Sequence:CCGGCGGGATTTATGAAGCCATTTACTCGAGTAAATGGCTTCATAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-167s1c1
Sequence:CCGGCGAGGTAACAGTCCTGAAATACTCGAGTATTTCAGGACTGTTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-441s1c1
Sequence:CCGGGCACAATATGATGTAGTGGTTCTCGAGAACCACTACATCATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-686s1c1
Sequence:CCGGCCAGCAATATGACTTTGCATTCTCGAGAATGCAAAGTCATATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028094
UGT2A3 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide A3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028094.1-1719s1c1
Sequence:CCGGGCTCTGTTTCAGACTGGAAATCTCGAGATTTCCAGTCTGAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-1148s1c1
Sequence:CCGGCGGGATTTATGAAGCCATTTACTCGAGTAAATGGCTTCATAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-167s1c1
Sequence:CCGGCGAGGTAACAGTCCTGAAATACTCGAGTATTTCAGGACTGTTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-441s1c1
Sequence:CCGGGCACAATATGATGTAGTGGTTCTCGAGAACCACTACATCATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-686s1c1
Sequence:CCGGCCAGCAATATGACTTTGCATTCTCGAGAATGCAAAGTCATATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028094
UGT2A3 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide A3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028094.1-1719s1c1
Sequence:CCGGGCTCTGTTTCAGACTGGAAATCTCGAGATTTCCAGTCTGAAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-1148s1c1
Sequence:CCGGCGGGATTTATGAAGCCATTTACTCGAGTAAATGGCTTCATAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-167s1c1
Sequence:CCGGCGAGGTAACAGTCCTGAAATACTCGAGTATTTCAGGACTGTTACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-441s1c1
Sequence:CCGGGCACAATATGATGTAGTGGTTCTCGAGAACCACTACATCATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028094.1-686s1c1
Sequence:CCGGCCAGCAATATGACTTTGCATTCTCGAGAATGCAAAGTCATATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks