EMAIL THIS PAGE TO A FRIEND

UGT2B10

UDP glucuronosyltransferase 2 family, polypeptide B10

Synonyms: UDPGT2B10
UniProtKB ID: P36537, A8K9M3, Q14CR8
Gene ID:
Rat(305264) UDP glucuronosyltransferase 2 family, polypeptide B10
cow(533587) UDP glucuronosyltransferase 2 family, polypeptide B10
naked mole-rat(101708308) UDP glucuronosyltransferase 2 family, polypeptide B10
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001075 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152781 MISSION® esiRNA esiRNA human UGT2B10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001075 Rosetta Predictions human pricing
XM_001074665 Rosetta Predictions rat pricing
XM_223299 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063473 predicted 520
2 SASI_Hs01_00063474 predicted 355
3 SASI_Hs01_00063475 predicted 28
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346935 predicted 374
2 SASI_Rn02_00346936 predicted 242
3 SASI_Rn02_00346937 predicted 412
4 SASI_Rn02_00346938 predicted 1205
5 SASI_Rn02_00346939 predicted 242
6 SASI_Rn02_00346940 predicted 1317
7 SASI_Rn02_00346941 predicted 227
8 SASI_Rn02_00346942 predicted 1212
9 SASI_Rn02_00346943 predicted 133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381241 predicted 368
2 SASI_Rn02_00381242 predicted 241
3 SASI_Rn02_00381243 predicted 408
4 SASI_Rn02_00381244 predicted 1210
5 SASI_Rn02_00381245 predicted 247
6 SASI_Rn02_00381246 predicted 1316
7 SASI_Rn02_00381247 predicted 223
8 SASI_Rn02_00381248 predicted 1211
9 SASI_Rn02_00381249 predicted 140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001075
UGT2B10 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide B10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001075.4-1902s21c1
Sequence:CCGGCTTCAGCCTCAACTTACTAAGCTCGAGCTTAGTAAGTTGAGGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-355s1c1
Sequence:CCGGGTGGGCAATTAATGACATAATCTCGAGATTATGTCATTAATTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-216s1c1
Sequence:CCGGCCACTCTTAAACTTGAAGTTTCTCGAGAAACTTCAAGTTTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-806s1c1
Sequence:CCGGCCTCATCCATTCTTACCAAATCTCGAGATTTGGTAAGAATGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-208s1c1
Sequence:CCGGCGACTCATCCACTCTTAAACTCTCGAGAGTTTAAGAGTGGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-97s1c1
Sequence:CCGGCGCAGAATACAGCCTTTGGATCTCGAGATCCAAAGGCTGTATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001075
UGT2B10 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide B10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001075.4-1902s21c1
Sequence:CCGGCTTCAGCCTCAACTTACTAAGCTCGAGCTTAGTAAGTTGAGGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-355s1c1
Sequence:CCGGGTGGGCAATTAATGACATAATCTCGAGATTATGTCATTAATTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-216s1c1
Sequence:CCGGCCACTCTTAAACTTGAAGTTTCTCGAGAAACTTCAAGTTTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-806s1c1
Sequence:CCGGCCTCATCCATTCTTACCAAATCTCGAGATTTGGTAAGAATGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-208s1c1
Sequence:CCGGCGACTCATCCACTCTTAAACTCTCGAGAGTTTAAGAGTGGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-97s1c1
Sequence:CCGGCGCAGAATACAGCCTTTGGATCTCGAGATCCAAAGGCTGTATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001075
UGT2B10 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide B10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001075.4-1902s21c1
Sequence:CCGGCTTCAGCCTCAACTTACTAAGCTCGAGCTTAGTAAGTTGAGGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-355s1c1
Sequence:CCGGGTGGGCAATTAATGACATAATCTCGAGATTATGTCATTAATTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-216s1c1
Sequence:CCGGCCACTCTTAAACTTGAAGTTTCTCGAGAAACTTCAAGTTTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-806s1c1
Sequence:CCGGCCTCATCCATTCTTACCAAATCTCGAGATTTGGTAAGAATGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-208s1c1
Sequence:CCGGCGACTCATCCACTCTTAAACTCTCGAGAGTTTAAGAGTGGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001075.2-97s1c1
Sequence:CCGGCGCAGAATACAGCCTTTGGATCTCGAGATCCAAAGGCTGTATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks