EMAIL THIS PAGE TO A FRIEND

UGT2B15

UDP glucuronosyltransferase 2 family, polypeptide B15

Synonyms: HLUG4 UDPGT 2B8 UDPGT2B15 UDPGTH3 UGT2B8
UniProtKB ID: P54855, A6NDX0, A6NNJ4, P23765, Q9UK63
Gene ID:
Human(7366) Summary: This gene encodes a member of the UDP-glycosyltransferase (UDPGT) family. The UDPGTs are of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This protein displays activity towards several classes of xenobiotic substrates, including simple phenolic compounds, 7-hydroxylated coumarins, flavonoids, anthraquinones, and certain drugs and their hydroxylated metabolites. It also catalyzes the glucuronidation of endogenous estrogens and androgens. [provided by RefSeq, Oct 2011]
Rat(83808) UDP glucuronosyltransferase 2 family, polypeptide B15
cow(540544) UDP glucuronosyltransferase 2 family, polypeptide B15
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001076 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076 Rosetta Predictions human pricing
NM_001004271 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074893 predicted 535
2 SASI_Hs01_00074891 predicted 400
3 SASI_Hs01_00074892 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119342 predicted 1620
2 SASI_Rn01_00119343 predicted 822
3 SASI_Rn01_00119344 predicted 410
4 SASI_Rn01_00119345 predicted 360
5 SASI_Rn02_00198302 predicted 407
6 SASI_Rn01_00119346 predicted 291
7 SASI_Rn01_00119348 predicted 358
8 SASI_Rn01_00119349 predicted 1287
9 SASI_Rn01_00119350 predicted 1609
10 SASI_Rn02_00198303 predicted 1284
11 SASI_Rn01_00119347 predicted 224
12 SASI_Rn01_00119351 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001076
UGT2B15 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide B15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076.2-393s21c1
Sequence:CCGGGAATATTATGACTACAGTAACCTCGAGGTTACTGTAGTCATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076.2-1905s21c1
Sequence:CCGGCACGCCAACATGGCACATGTACTCGAGTACATGTGCCATGTTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076.2-542s21c1
Sequence:CCGGCTTTCTGTACAGTCTTCGATTCTCGAGAATCGAAGACTGTACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-435s1c1
Sequence:CCGGGATGAAACTACAAGAGTCAAACTCGAGTTTGACTCTTGTAGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-218s1c1
Sequence:CCGGCCAGTAAATCATCTGCTATTACTCGAGTAATAGCAGATGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-1054s1c1
Sequence:CCGGCCAAATACATTAGGTTCCAATCTCGAGATTGGAACCTAATGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-1523s1c1
Sequence:CCGGGCGTGGCAACTGTGATATTTACTCGAGTAAATATCACAGTTGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-826s1c1
Sequence:CCGGCGCCCATTCTTACCAAATGTTCTCGAGAACATTTGGTAAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001076
UGT2B15 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide B15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076.2-393s21c1
Sequence:CCGGGAATATTATGACTACAGTAACCTCGAGGTTACTGTAGTCATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076.2-1905s21c1
Sequence:CCGGCACGCCAACATGGCACATGTACTCGAGTACATGTGCCATGTTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076.2-542s21c1
Sequence:CCGGCTTTCTGTACAGTCTTCGATTCTCGAGAATCGAAGACTGTACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-435s1c1
Sequence:CCGGGATGAAACTACAAGAGTCAAACTCGAGTTTGACTCTTGTAGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-218s1c1
Sequence:CCGGCCAGTAAATCATCTGCTATTACTCGAGTAATAGCAGATGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-1054s1c1
Sequence:CCGGCCAAATACATTAGGTTCCAATCTCGAGATTGGAACCTAATGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-1523s1c1
Sequence:CCGGGCGTGGCAACTGTGATATTTACTCGAGTAAATATCACAGTTGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-826s1c1
Sequence:CCGGCGCCCATTCTTACCAAATGTTCTCGAGAACATTTGGTAAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001076
UGT2B15 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide B15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076.2-393s21c1
Sequence:CCGGGAATATTATGACTACAGTAACCTCGAGGTTACTGTAGTCATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076.2-1905s21c1
Sequence:CCGGCACGCCAACATGGCACATGTACTCGAGTACATGTGCCATGTTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076.2-542s21c1
Sequence:CCGGCTTTCTGTACAGTCTTCGATTCTCGAGAATCGAAGACTGTACAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-435s1c1
Sequence:CCGGGATGAAACTACAAGAGTCAAACTCGAGTTTGACTCTTGTAGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-218s1c1
Sequence:CCGGCCAGTAAATCATCTGCTATTACTCGAGTAATAGCAGATGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-1054s1c1
Sequence:CCGGCCAAATACATTAGGTTCCAATCTCGAGATTGGAACCTAATGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-1523s1c1
Sequence:CCGGGCGTGGCAACTGTGATATTTACTCGAGTAAATATCACAGTTGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001076.1-826s1c1
Sequence:CCGGCGCCCATTCTTACCAAATGTTCTCGAGAACATTTGGTAAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks