EMAIL THIS PAGE TO A FRIEND

UGT2B17

UDP glucuronosyltransferase 2 family, polypeptide B17

Synonyms: BMND12 UDPGT2B17
UniProtKB ID: O75795
Gene ID:
Human(7367) Summary: This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Copy number variation in this gene is associated with susceptibility to osteoporosis.[provided by RefSeq, Apr 2010]
Rat(266685) UDP glucuronosyltransferase 2 family, polypeptide B17
domestic guinea pig(100726998) UDP glucuronosyltransferase 2 family, polypeptide B17
cow(540615) UDP glucuronosyltransferase 2 family, polypeptide B17
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301563 ANTI-UDB17 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077 Rosetta Predictions human pricing
NM_153314 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139932 predicted 389
2 SASI_Hs01_00139933 predicted 1544
3 SASI_Hs01_00139934 predicted 396
4 SASI_Hs01_00139935 predicted 1542
5 SASI_Hs01_00139936 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117098 predicted 397
2 SASI_Rn01_00117099 predicted 601
3 SASI_Rn01_00117100 predicted 389
4 SASI_Rn01_00117101 predicted 1583
5 SASI_Rn01_00117104 predicted 66
6 SASI_Rn01_00117102 predicted 1310
7 SASI_Rn01_00117103 predicted 1313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077
UGT2B17 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide B17
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1554s1c1
Sequence:CCGGCGTGGCAACTATGATATTTATCTCGAGATAAATATCATAGTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1084s1c1
Sequence:CCGGCCAAATACTTTAGGTTCCAATCTCGAGATTGGAACCTAAAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-329s1c1
Sequence:CCGGTGTTCGATAGATGGACATATACTCGAGTATATGTCCATCTATCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1243s1c1
Sequence:CCGGGCGGATCAACATGATAACATTCTCGAGAATGTTATCATGTTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1795s21c1
Sequence:CCGGGTACTTTAGTTGGAATTATTCCTCGAGGAATAATTCCAACTAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1917s21c1
Sequence:CCGGTACTGAGCTTCCTTATGTTTCCTCGAGGAAACATAAGGAAGCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1648s21c1
Sequence:CCGGGCCTGAAGTGGAATGACCAAACTCGAGTTTGGTCATTCCACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1859s21c1
Sequence:CCGGCTTATGGGCTTATATTGAAATCTCGAGATTTCAATATAAGCCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-1548s21c1
Sequence:CCGGTGGCAACTATGATATTTATGACTCGAGTCATAAATATCATAGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-395s21c1
Sequence:CCGGTGGGAATATTCTGACTATAATCTCGAGATTATAGTCAGAATATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-328s21c1
Sequence:CCGGTAGATGGACATATAGTATTTCCTCGAGGAAATACTATATGTCCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-320s21c1
Sequence:CCGGATGTTCGATAGATGGACATATCTCGAGATATGTCCATCTATCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077
UGT2B17 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide B17
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1554s1c1
Sequence:CCGGCGTGGCAACTATGATATTTATCTCGAGATAAATATCATAGTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1084s1c1
Sequence:CCGGCCAAATACTTTAGGTTCCAATCTCGAGATTGGAACCTAAAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-329s1c1
Sequence:CCGGTGTTCGATAGATGGACATATACTCGAGTATATGTCCATCTATCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1243s1c1
Sequence:CCGGGCGGATCAACATGATAACATTCTCGAGAATGTTATCATGTTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1795s21c1
Sequence:CCGGGTACTTTAGTTGGAATTATTCCTCGAGGAATAATTCCAACTAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1917s21c1
Sequence:CCGGTACTGAGCTTCCTTATGTTTCCTCGAGGAAACATAAGGAAGCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1648s21c1
Sequence:CCGGGCCTGAAGTGGAATGACCAAACTCGAGTTTGGTCATTCCACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1859s21c1
Sequence:CCGGCTTATGGGCTTATATTGAAATCTCGAGATTTCAATATAAGCCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-1548s21c1
Sequence:CCGGTGGCAACTATGATATTTATGACTCGAGTCATAAATATCATAGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-395s21c1
Sequence:CCGGTGGGAATATTCTGACTATAATCTCGAGATTATAGTCAGAATATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-328s21c1
Sequence:CCGGTAGATGGACATATAGTATTTCCTCGAGGAAATACTATATGTCCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-320s21c1
Sequence:CCGGATGTTCGATAGATGGACATATCTCGAGATATGTCCATCTATCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077
UGT2B17 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide B17
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1554s1c1
Sequence:CCGGCGTGGCAACTATGATATTTATCTCGAGATAAATATCATAGTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1084s1c1
Sequence:CCGGCCAAATACTTTAGGTTCCAATCTCGAGATTGGAACCTAAAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-329s1c1
Sequence:CCGGTGTTCGATAGATGGACATATACTCGAGTATATGTCCATCTATCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001077.1-1243s1c1
Sequence:CCGGGCGGATCAACATGATAACATTCTCGAGAATGTTATCATGTTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1795s21c1
Sequence:CCGGGTACTTTAGTTGGAATTATTCCTCGAGGAATAATTCCAACTAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1917s21c1
Sequence:CCGGTACTGAGCTTCCTTATGTTTCCTCGAGGAAACATAAGGAAGCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1648s21c1
Sequence:CCGGGCCTGAAGTGGAATGACCAAACTCGAGTTTGGTCATTCCACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077.2-1859s21c1
Sequence:CCGGCTTATGGGCTTATATTGAAATCTCGAGATTTCAATATAAGCCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-1548s21c1
Sequence:CCGGTGGCAACTATGATATTTATGACTCGAGTCATAAATATCATAGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-395s21c1
Sequence:CCGGTGGGAATATTCTGACTATAATCTCGAGATTATAGTCAGAATATTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-328s21c1
Sequence:CCGGTAGATGGACATATAGTATTTCCTCGAGGAAATACTATATGTCCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077.2-320s21c1
Sequence:CCGGATGTTCGATAGATGGACATATCTCGAGATATGTCCATCTATCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks