EMAIL THIS PAGE TO A FRIEND

UGT2B28

UDP glucuronosyltransferase 2 family, polypeptide B28

Species: Human UGT2B28(54490)
UniProtKB ID: Q9BY64, B5BUM0, Q9BY62, Q9BY63
Gene ID:
Human(54490) Summary: This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Two transcript variants encoding different isoforms have been found for this gene. While both isoforms are targeted to the endoplasmic reticulum, only the longer isoform appears to be active. [provided by RefSeq, May 2011]
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305950 ANTI-UGT2B28 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053039 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053039 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115555 predicted 1235
2 SASI_Hs01_00115556 predicted 343
3 SASI_Hs01_00115557 predicted 345
4 SASI_Hs01_00115558 predicted 1611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053039
UGT2B28 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide B28
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053039.1-1339s21c1
Sequence:CCGGCAATAATTCAACATGATCAACCTCGAGGTTGATCATGTTGAATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053039.1-1404s21c1
Sequence:CCGGATGTGCCACAAAGGAGCCAAACTCGAGTTTGGCTCCTTTGTGGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053039.1-1619s21c1
Sequence:CCGGACCAGATAGATGGGTTGACATCTCGAGATGTCAACCCATCTATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-486s1c1
Sequence:CCGGGCGCTACTTAACATACCGTTTCTCGAGAAACGGTATGTTAAGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-92s1c1
Sequence:CCGGCGGTGAATACAGCCATTGGATCTCGAGATCCAATGGCTGTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-1377s1c1
Sequence:CCGGCGAGCAGTCTTCTGGATTGAACTCGAGTTCAATCCAGAAGACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-350s1c1
Sequence:CCGGGTGGGAATTTCATGACATATTCTCGAGAATATGTCATGAAATTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053039
UGT2B28 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide B28
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053039.1-1339s21c1
Sequence:CCGGCAATAATTCAACATGATCAACCTCGAGGTTGATCATGTTGAATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053039.1-1404s21c1
Sequence:CCGGATGTGCCACAAAGGAGCCAAACTCGAGTTTGGCTCCTTTGTGGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053039.1-1619s21c1
Sequence:CCGGACCAGATAGATGGGTTGACATCTCGAGATGTCAACCCATCTATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-486s1c1
Sequence:CCGGGCGCTACTTAACATACCGTTTCTCGAGAAACGGTATGTTAAGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-92s1c1
Sequence:CCGGCGGTGAATACAGCCATTGGATCTCGAGATCCAATGGCTGTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-1377s1c1
Sequence:CCGGCGAGCAGTCTTCTGGATTGAACTCGAGTTCAATCCAGAAGACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-350s1c1
Sequence:CCGGGTGGGAATTTCATGACATATTCTCGAGAATATGTCATGAAATTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053039
UGT2B28 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide B28
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053039.1-1339s21c1
Sequence:CCGGCAATAATTCAACATGATCAACCTCGAGGTTGATCATGTTGAATTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053039.1-1404s21c1
Sequence:CCGGATGTGCCACAAAGGAGCCAAACTCGAGTTTGGCTCCTTTGTGGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053039.1-1619s21c1
Sequence:CCGGACCAGATAGATGGGTTGACATCTCGAGATGTCAACCCATCTATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-486s1c1
Sequence:CCGGGCGCTACTTAACATACCGTTTCTCGAGAAACGGTATGTTAAGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-92s1c1
Sequence:CCGGCGGTGAATACAGCCATTGGATCTCGAGATCCAATGGCTGTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-1377s1c1
Sequence:CCGGCGAGCAGTCTTCTGGATTGAACTCGAGTTCAATCCAGAAGACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053039.1-350s1c1
Sequence:CCGGGTGGGAATTTCATGACATATTCTCGAGAATATGTCATGAAATTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks