EMAIL THIS PAGE TO A FRIEND

UGT2B4

UDP glucuronosyltransferase 2 family, polypeptide B4

Synonyms: HLUG25 UDPGT2B4 UDPGTH1 UGT2B11
UniProtKB ID: P06133, O60731, O60867, O75614, P36538, Q1HBF9
Gene ID:
cow(615303) UDP glucuronosyltransferase 2 family, polypeptide B4
dog(480777) UDP glucuronosyltransferase 2 family, polypeptide B4
Horse(100066359) UDP glucuronosyltransferase 2 family, polypeptide B4
dog(608760) UDP glucuronosyltransferase 2 family, polypeptide B4
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021139 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021139 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042023 predicted 1074
2 SASI_Hs01_00042024 predicted 399
3 SASI_Hs01_00042025 predicted 1659
4 SASI_Hs01_00042026 predicted 1656
5 SASI_Hs01_00042027 predicted 1284
6 SASI_Hs01_00042028 predicted 419
7 SASI_Hs01_00042029 predicted 1316
8 SASI_Hs01_00042030 predicted 452
9 SASI_Hs02_00354663 predicted 381
10 SASI_Hs02_00354664 predicted 1313
11 SASI_Hs01_00042022 predicted 1063
12 SASI_Hs01_00042031 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021139
UGT2B4 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide B4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-238s1c1
Sequence:CCGGCAGCCCATCTACTCTTAAATTCTCGAGAATTTAAGAGTAGATGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-461s1c1
Sequence:CCGGGAGTCAAGATTTGATGTTGTTCTCGAGAACAACATCAAATCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-902s1c1
Sequence:CCGGCCGAAGGAAATGGAAGAGTTTCTCGAGAAACTCTTCCATTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-1067s1c1
Sequence:CCGGCCAGATACTTTAGGACTCAATCTCGAGATTGAGTCCTAAAGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021139.2-521s21c1
Sequence:CCGGGCTGCTGGCCGAGTTACTTAACTCGAGTTAAGTAACTCGGCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021139.2-567s21c1
Sequence:CCGGTTCTCTCCTGGCTACGCAATTCTCGAGAATTGCGTAGCCAGGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021139
UGT2B4 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide B4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-238s1c1
Sequence:CCGGCAGCCCATCTACTCTTAAATTCTCGAGAATTTAAGAGTAGATGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-461s1c1
Sequence:CCGGGAGTCAAGATTTGATGTTGTTCTCGAGAACAACATCAAATCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-902s1c1
Sequence:CCGGCCGAAGGAAATGGAAGAGTTTCTCGAGAAACTCTTCCATTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-1067s1c1
Sequence:CCGGCCAGATACTTTAGGACTCAATCTCGAGATTGAGTCCTAAAGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021139.2-521s21c1
Sequence:CCGGGCTGCTGGCCGAGTTACTTAACTCGAGTTAAGTAACTCGGCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021139.2-567s21c1
Sequence:CCGGTTCTCTCCTGGCTACGCAATTCTCGAGAATTGCGTAGCCAGGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021139
UGT2B4 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide B4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-238s1c1
Sequence:CCGGCAGCCCATCTACTCTTAAATTCTCGAGAATTTAAGAGTAGATGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-461s1c1
Sequence:CCGGGAGTCAAGATTTGATGTTGTTCTCGAGAACAACATCAAATCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-902s1c1
Sequence:CCGGCCGAAGGAAATGGAAGAGTTTCTCGAGAAACTCTTCCATTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021139.1-1067s1c1
Sequence:CCGGCCAGATACTTTAGGACTCAATCTCGAGATTGAGTCCTAAAGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021139.2-521s21c1
Sequence:CCGGGCTGCTGGCCGAGTTACTTAACTCGAGTTAAGTAACTCGGCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021139.2-567s21c1
Sequence:CCGGTTCTCTCCTGGCTACGCAATTCTCGAGAATTGCGTAGCCAGGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks