EMAIL THIS PAGE TO A FRIEND

UGT2B7

UDP glucuronosyltransferase 2 family, polypeptide B7

Synonyms: UDPGT 2B9 UDPGT2B7 UDPGTH2 UGT2B9
UniProtKB ID: P16662, B2R810, Q6GTW0
Gene ID:
Human(7364) Summary: The protein encoded by this gene belongs to the UDP-glycosyltransferase (UGT) family. UGTs serve a major role in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This protein is localized in the microsome membrane, and has unique specificity for 3,4-catechol estrogens and estriol, suggesting that it may play an important role in regulating the level and activity of these potent estrogen metabolites. [provided by RefSeq, Sep 2011]
Rat(286989) UDP glucuronosyltransferase 2 family, polypeptide B7
sheep(100534650) UDP glucuronosyltransferase 2 family, polypeptide B7
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001074 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001074 Rosetta Predictions human pricing
NM_173323 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207594 predicted 1294
2 SASI_Hs01_00207595 predicted 345
3 SASI_Hs01_00207596 predicted 369
4 SASI_Hs01_00207597 predicted 1187
5 SASI_Hs01_00207598 predicted 1289
6 SASI_Hs01_00207599 predicted 227
7 SASI_Hs01_00207600 predicted 1672
8 SASI_Hs01_00207601 predicted 1655
9 SASI_Hs02_00311905 predicted 839
10 SASI_Hs01_00207602 predicted 46
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060248 predicted 458
2 SASI_Rn01_00060249 predicted 1707
3 SASI_Rn01_00060250 predicted 752
4 SASI_Rn01_00060253 predicted 391
5 SASI_Rn01_00060254 predicted 260
6 SASI_Rn01_00060255 predicted 504
7 SASI_Rn02_00269433 predicted 712
8 SASI_Rn01_00060256 predicted 1195
9 SASI_Rn01_00060257 predicted 625
10 SASI_Rn02_00269434 predicted 1156
11 SASI_Rn01_00060251 predicted 1232
12 SASI_Rn01_00060252 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001074
UGT2B7 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide B7
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000036204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001074.1-1664s1c1
Sequence:CCGGGCAAGAAAGATTGTGATGCAACTCGAGTTGCATCACAATCTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001074.1-347s1c1
Sequence:CCGGAGTACAGGAAATCATGTCAATCTCGAGATTGACATGATTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001074.1-879s1c1
Sequence:CCGGCCTAAGGAAATGGAAGACTTTCTCGAGAAAGTCTTCCATTTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001074
UGT2B7 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide B7
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000036204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001074.1-1664s1c1
Sequence:CCGGGCAAGAAAGATTGTGATGCAACTCGAGTTGCATCACAATCTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001074.1-347s1c1
Sequence:CCGGAGTACAGGAAATCATGTCAATCTCGAGATTGACATGATTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001074.1-879s1c1
Sequence:CCGGCCTAAGGAAATGGAAGACTTTCTCGAGAAAGTCTTCCATTTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001074
UGT2B7 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide B7
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000036204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001074.1-1664s1c1
Sequence:CCGGGCAAGAAAGATTGTGATGCAACTCGAGTTGCATCACAATCTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001074.1-347s1c1
Sequence:CCGGAGTACAGGAAATCATGTCAATCTCGAGATTGACATGATTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001074.1-879s1c1
Sequence:CCGGCCTAAGGAAATGGAAGACTTTCTCGAGAAAGTCTTCCATTTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks