EMAIL THIS PAGE TO A FRIEND

UGT3A1

UDP glycosyltransferase 3 family, polypeptide A1

UniProtKB ID: Q6NUS8, G5E961, Q8IYS9, Q8NAW4, Q96DM6
Gene ID:
Mouse(105887) UDP glycosyltransferases 3 family, polypeptide A1
domestic cat(101099779) UDP glycosyltransferase 3 family, polypeptide A1
dog(489234) UDP glycosyltransferase 3 family, polypeptide A1
cow(525484) UDP glycosyltransferase 3 family, polypeptide A1
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115431 MISSION® esiRNA esiRNA human UGT3A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152404 Rosetta Predictions human pricing
NM_207216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103785 predicted 576
2 SASI_Hs01_00103786 predicted 1126
3 SASI_Hs01_00103787 predicted 1132
4 SASI_Hs01_00103788 predicted 571
5 SASI_Hs01_00103789 predicted 1312
6 SASI_Hs01_00103790 predicted 250
7 SASI_Hs01_00103792 predicted 510
8 SASI_Hs02_00366089 predicted 516
9 SASI_Hs01_00103793 predicted 1168
10 SASI_Hs02_00366090 predicted 1004
11 SASI_Hs01_00103784 predicted 573
12 SASI_Hs01_00103791 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106492 predicted 419
2 SASI_Mm01_00106493 predicted 785
3 SASI_Mm01_00106494 predicted 1590
4 SASI_Mm01_00106495 predicted 444
5 SASI_Mm02_00351938 predicted 555
6 SASI_Mm01_00106496 predicted 232
7 SASI_Mm01_00106497 predicted 1747
8 SASI_Mm01_00106498 predicted 1686
9 SASI_Mm01_00106499 predicted 272
10 SASI_Mm01_00106500 predicted 1588
11 SASI_Mm01_00106501 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152404
UGT3A1 MISSION shRNA Bacterial Glycerol Stock
UDP glycosyltransferase 3 family, polypeptide A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-696s1c1
Sequence:CCGGCCTTGTCTTATGTTCCAGTATCTCGAGATACTGGAACATAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-1172s1c1
Sequence:CCGGGATGTTCATTTGGCCACAAATCTCGAGATTTGTGGCCAAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-1411s1c1
Sequence:CCGGCACACTGACACTTACAATGAACTCGAGTTCATTGTAAGTGTCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-483s1c1
Sequence:CCGGCCCTTGTAAAGCTAATGGAAACTCGAGTTTCCATTAGCTTTACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152404.2-1603s1c1
Sequence:CCGGGCAGTACCTCATTGATGTCTTCTCGAGAAGACATCAATGAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-836s21c1
Sequence:CCGGTGGGACATGCAGTCTACATTTCTCGAGAAATGTAGACTGCATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-1300s21c1
Sequence:CCGGTGGTGGGCAGAACAGCGTAATCTCGAGATTACGCTGTTCTGCCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152404.3-2172s21c1
Sequence:CCGGATATCTTGCCCTTCCTATAAGCTCGAGCTTATAGGAAGGGCAAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-1641s21c1
Sequence:CCGGAGTACCTCATTGATGTCTTTGCTCGAGCAAAGACATCAATGAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152404
UGT3A1 MISSION shRNA shRNA Plasmid DNA
UDP glycosyltransferase 3 family, polypeptide A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-696s1c1
Sequence:CCGGCCTTGTCTTATGTTCCAGTATCTCGAGATACTGGAACATAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-1172s1c1
Sequence:CCGGGATGTTCATTTGGCCACAAATCTCGAGATTTGTGGCCAAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-1411s1c1
Sequence:CCGGCACACTGACACTTACAATGAACTCGAGTTCATTGTAAGTGTCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-483s1c1
Sequence:CCGGCCCTTGTAAAGCTAATGGAAACTCGAGTTTCCATTAGCTTTACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152404.2-1603s1c1
Sequence:CCGGGCAGTACCTCATTGATGTCTTCTCGAGAAGACATCAATGAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-836s21c1
Sequence:CCGGTGGGACATGCAGTCTACATTTCTCGAGAAATGTAGACTGCATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-1300s21c1
Sequence:CCGGTGGTGGGCAGAACAGCGTAATCTCGAGATTACGCTGTTCTGCCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152404.3-2172s21c1
Sequence:CCGGATATCTTGCCCTTCCTATAAGCTCGAGCTTATAGGAAGGGCAAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-1641s21c1
Sequence:CCGGAGTACCTCATTGATGTCTTTGCTCGAGCAAAGACATCAATGAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152404
UGT3A1 MISSION shRNA Lentiviral Transduction Particles
UDP glycosyltransferase 3 family, polypeptide A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-696s1c1
Sequence:CCGGCCTTGTCTTATGTTCCAGTATCTCGAGATACTGGAACATAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-1172s1c1
Sequence:CCGGGATGTTCATTTGGCCACAAATCTCGAGATTTGTGGCCAAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-1411s1c1
Sequence:CCGGCACACTGACACTTACAATGAACTCGAGTTCATTGTAAGTGTCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152404.2-483s1c1
Sequence:CCGGCCCTTGTAAAGCTAATGGAAACTCGAGTTTCCATTAGCTTTACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152404.2-1603s1c1
Sequence:CCGGGCAGTACCTCATTGATGTCTTCTCGAGAAGACATCAATGAGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-836s21c1
Sequence:CCGGTGGGACATGCAGTCTACATTTCTCGAGAAATGTAGACTGCATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-1300s21c1
Sequence:CCGGTGGTGGGCAGAACAGCGTAATCTCGAGATTACGCTGTTCTGCCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152404.3-2172s21c1
Sequence:CCGGATATCTTGCCCTTCCTATAAGCTCGAGCTTATAGGAAGGGCAAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152404.3-1641s21c1
Sequence:CCGGAGTACCTCATTGATGTCTTTGCTCGAGCAAAGACATCAATGAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127943
UGT3A1 MISSION shRNA Bacterial Glycerol Stock
UDP glycosyltransferase 3 family, polypeptide A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127943.2-1757s1c1
Sequence:CCGGCCTTCCATAATTCAGTACATACTCGAGTATGTACTGAATTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-474s1c1
Sequence:CCGGGCGGACTTATGCAGTCACTTACTCGAGTAAGTGACTGCATAAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-402s1c1
Sequence:CCGGCATCGACTTATAGACGAATATCTCGAGATATTCGTCTATAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-1527s1c1
Sequence:CCGGGCAGCACATCTCAAGCCATATCTCGAGATATGGCTTGAGATGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-223s1c1
Sequence:CCGGCCAGTCATTATATACTGATGACTCGAGTCATCAGTATATAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127943
UGT3A1 MISSION shRNA shRNA Plasmid DNA
UDP glycosyltransferase 3 family, polypeptide A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127943.2-1757s1c1
Sequence:CCGGCCTTCCATAATTCAGTACATACTCGAGTATGTACTGAATTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-474s1c1
Sequence:CCGGGCGGACTTATGCAGTCACTTACTCGAGTAAGTGACTGCATAAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-402s1c1
Sequence:CCGGCATCGACTTATAGACGAATATCTCGAGATATTCGTCTATAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-1527s1c1
Sequence:CCGGGCAGCACATCTCAAGCCATATCTCGAGATATGGCTTGAGATGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-223s1c1
Sequence:CCGGCCAGTCATTATATACTGATGACTCGAGTCATCAGTATATAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127943
UGT3A1 MISSION shRNA Lentiviral Transduction Particles
UDP glycosyltransferase 3 family, polypeptide A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127943.2-1757s1c1
Sequence:CCGGCCTTCCATAATTCAGTACATACTCGAGTATGTACTGAATTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-474s1c1
Sequence:CCGGGCGGACTTATGCAGTCACTTACTCGAGTAAGTGACTGCATAAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-402s1c1
Sequence:CCGGCATCGACTTATAGACGAATATCTCGAGATATTCGTCTATAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-1527s1c1
Sequence:CCGGGCAGCACATCTCAAGCCATATCTCGAGATATGGCTTGAGATGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127943.2-223s1c1
Sequence:CCGGCCAGTCATTATATACTGATGACTCGAGTCATCAGTATATAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks