EMAIL THIS PAGE TO A FRIEND

UGT3A2

UDP glycosyltransferase 3 family, polypeptide A2

UniProtKB ID: Q3SY77, B4DUQ7, E9PFK7, Q6UXC4, Q8NBP2
Gene ID:
Mouse(223337) UDP glycosyltransferases 3 family, polypeptide A2
Rat(294793) UDP glycosyltransferase 3 family, polypeptide A2
Domestic Rabbit(100353356) UDP glycosyltransferase 3 family, polypeptide A2
naked mole-rat(101720886) UDP glycosyltransferase 3 family, polypeptide A2
domestic guinea pig(100720972) UDP glycosyltransferase 3 family, polypeptide A2
dog(489230) UDP glycosyltransferase 3 family, polypeptide A2
domestic cat(101097701) UDP glycosyltransferase 3 family, polypeptide A2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110121 MISSION® esiRNA esiRNA human UGT3A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174914 Rosetta Predictions human pricing
XM_001057451 Rosetta Predictions rat pricing
XM_226821 Rosetta Predictions rat pricing
NM_144845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190248 predicted 1343
2 SASI_Hs01_00190249 predicted 1363
3 SASI_Hs01_00190250 predicted 499
4 SASI_Hs01_00190251 predicted 758
5 SASI_Hs01_00190253 predicted 820
6 SASI_Hs01_00190254 predicted 1017
7 SASI_Hs01_00190256 predicted 830
8 SASI_Hs02_00368827 predicted 586
9 SASI_Hs02_00368828 predicted 1347
10 SASI_Hs01_00190247 predicted 1306
11 SASI_Hs01_00190252 predicted 540
12 SASI_Hs01_00190255 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286400 predicted 390
2 SASI_Rn02_00286401 predicted 195
3 SASI_Rn02_00286402 predicted 226
4 SASI_Rn02_00286403 predicted 553
5 SASI_Rn02_00286404 predicted 565
6 SASI_Rn02_00286405 predicted 296
7 SASI_Rn02_00286406 predicted 606
8 SASI_Rn02_00286407 predicted 282
9 SASI_Rn02_00286408 predicted 1050
10 SASI_Rn02_00286409 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383905 predicted 383
2 SASI_Rn02_00383906 predicted 194
3 SASI_Rn02_00383907 predicted 229
4 SASI_Rn02_00383908 predicted 550
5 SASI_Rn02_00383909 predicted 569
6 SASI_Rn02_00383910 predicted 297
7 SASI_Rn02_00383911 predicted 604
8 SASI_Rn02_00383912 predicted 282
9 SASI_Rn02_00383913 predicted 1049
10 SASI_Rn02_00383914 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120596 predicted 355
2 SASI_Mm01_00120597 predicted 254
3 SASI_Mm01_00120598 predicted 740
4 SASI_Mm01_00120599 predicted 303
5 SASI_Mm01_00120600 predicted 412
6 SASI_Mm02_00340245 predicted 531
7 SASI_Mm01_00120601 predicted 746
8 SASI_Mm01_00120602 predicted 378
9 SASI_Mm01_00120603 predicted 1733
10 SASI_Mm01_00120604 predicted 256
11 SASI_Mm01_00120595 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174914
UGT3A2 MISSION shRNA Bacterial Glycerol Stock
UDP glycosyltransferase 3 family, polypeptide A2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174914.3-1987s21c1
Sequence:CCGGGGACCACTGACCCTCAGATTTCTCGAGAAATCTGAGGGTCAGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174914.3-622s21c1
Sequence:CCGGGCCATTCTTTCCACTTCATTCCTCGAGGAATGAAGTGGAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-1209s1c1
Sequence:CCGGGAATAGCATAATGGAGGCCATCTCGAGATGGCCTCCATTATGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-843s1c1
Sequence:CCGGCTCTGACTTTGCCTTTGATTTCTCGAGAAATCAAAGGCAAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-173s1c1
Sequence:CCGGCAATATCTACAGTAGGTGGAACTCGAGTTCCACCTACTGTAGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-502s1c1
Sequence:CCGGGAGAACTTCGACATGGTGATACTCGAGTATCACCATGTCGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174914.2-1758s1c1
Sequence:CCGGCCTTCTAGTTATCTCCTGTTTCTCGAGAAACAGGAGATAACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174914
UGT3A2 MISSION shRNA shRNA Plasmid DNA
UDP glycosyltransferase 3 family, polypeptide A2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174914.3-1987s21c1
Sequence:CCGGGGACCACTGACCCTCAGATTTCTCGAGAAATCTGAGGGTCAGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174914.3-622s21c1
Sequence:CCGGGCCATTCTTTCCACTTCATTCCTCGAGGAATGAAGTGGAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-1209s1c1
Sequence:CCGGGAATAGCATAATGGAGGCCATCTCGAGATGGCCTCCATTATGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-843s1c1
Sequence:CCGGCTCTGACTTTGCCTTTGATTTCTCGAGAAATCAAAGGCAAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-173s1c1
Sequence:CCGGCAATATCTACAGTAGGTGGAACTCGAGTTCCACCTACTGTAGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-502s1c1
Sequence:CCGGGAGAACTTCGACATGGTGATACTCGAGTATCACCATGTCGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174914.2-1758s1c1
Sequence:CCGGCCTTCTAGTTATCTCCTGTTTCTCGAGAAACAGGAGATAACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174914
UGT3A2 MISSION shRNA Lentiviral Transduction Particles
UDP glycosyltransferase 3 family, polypeptide A2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174914.3-1987s21c1
Sequence:CCGGGGACCACTGACCCTCAGATTTCTCGAGAAATCTGAGGGTCAGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174914.3-622s21c1
Sequence:CCGGGCCATTCTTTCCACTTCATTCCTCGAGGAATGAAGTGGAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-1209s1c1
Sequence:CCGGGAATAGCATAATGGAGGCCATCTCGAGATGGCCTCCATTATGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-843s1c1
Sequence:CCGGCTCTGACTTTGCCTTTGATTTCTCGAGAAATCAAAGGCAAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-173s1c1
Sequence:CCGGCAATATCTACAGTAGGTGGAACTCGAGTTCCACCTACTGTAGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174914.2-502s1c1
Sequence:CCGGGAGAACTTCGACATGGTGATACTCGAGTATCACCATGTCGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174914.2-1758s1c1
Sequence:CCGGCCTTCTAGTTATCTCCTGTTTCTCGAGAAACAGGAGATAACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144845
UGT3A2 MISSION shRNA Bacterial Glycerol Stock
UDP glycosyltransferase 3 family, polypeptide A2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000426906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144845.3-266s21c1
Sequence:CCGGCTTTATGAAAGTGCTAATATCCTCGAGGATATTAGCACTTTCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1779s21c1
Sequence:CCGGCTACTGATGCACCCGAGTTAGCTCGAGCTAACTCGGGTGCATCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1832s21c1
Sequence:CCGGATGATCTTCATTCCTACTTAGCTCGAGCTAAGTAGGAATGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1719s21c1
Sequence:CCGGTCTTCAGAGGCCTTCCGTAATCTCGAGATTACGGAAGGCCTCTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144845
UGT3A2 MISSION shRNA shRNA Plasmid DNA
UDP glycosyltransferase 3 family, polypeptide A2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000426906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144845.3-266s21c1
Sequence:CCGGCTTTATGAAAGTGCTAATATCCTCGAGGATATTAGCACTTTCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1779s21c1
Sequence:CCGGCTACTGATGCACCCGAGTTAGCTCGAGCTAACTCGGGTGCATCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1832s21c1
Sequence:CCGGATGATCTTCATTCCTACTTAGCTCGAGCTAAGTAGGAATGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1719s21c1
Sequence:CCGGTCTTCAGAGGCCTTCCGTAATCTCGAGATTACGGAAGGCCTCTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144845
UGT3A2 MISSION shRNA Lentiviral Transduction Particles
UDP glycosyltransferase 3 family, polypeptide A2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000426906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144845.3-266s21c1
Sequence:CCGGCTTTATGAAAGTGCTAATATCCTCGAGGATATTAGCACTTTCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1779s21c1
Sequence:CCGGCTACTGATGCACCCGAGTTAGCTCGAGCTAACTCGGGTGCATCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1832s21c1
Sequence:CCGGATGATCTTCATTCCTACTTAGCTCGAGCTAAGTAGGAATGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144845.3-1719s21c1
Sequence:CCGGTCTTCAGAGGCCTTCCGTAATCTCGAGATTACGGAAGGCCTCTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181069
UGT3A2 MISSION shRNA Bacterial Glycerol Stock
UDP glycosyltransferase 3 family, polypeptide A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181069.1-995s1c1
Sequence:CCGGGCATGATTCAGTCCAAGGAAACTCGAGTTTCCTTGGACTGAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-347s1c1
Sequence:CCGGGCTGATCTTAGGCATCGACTTCTCGAGAAGTCGATGCCTAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-179s1c1
Sequence:CCGGGCAAGCCATTATATAGTGATACTCGAGTATCACTATATAATGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-700s1c1
Sequence:CCGGGTTCCTTGATTTCTCCATGAACTCGAGTTCATGGAGAAATCAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-358s1c1
Sequence:CCGGGCATCGACTTACAGAAGAAATCTCGAGATTTCTTCTGTAAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181069
UGT3A2 MISSION shRNA shRNA Plasmid DNA
UDP glycosyltransferase 3 family, polypeptide A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181069.1-995s1c1
Sequence:CCGGGCATGATTCAGTCCAAGGAAACTCGAGTTTCCTTGGACTGAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-347s1c1
Sequence:CCGGGCTGATCTTAGGCATCGACTTCTCGAGAAGTCGATGCCTAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-179s1c1
Sequence:CCGGGCAAGCCATTATATAGTGATACTCGAGTATCACTATATAATGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-700s1c1
Sequence:CCGGGTTCCTTGATTTCTCCATGAACTCGAGTTCATGGAGAAATCAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-358s1c1
Sequence:CCGGGCATCGACTTACAGAAGAAATCTCGAGATTTCTTCTGTAAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181069
UGT3A2 MISSION shRNA Lentiviral Transduction Particles
UDP glycosyltransferase 3 family, polypeptide A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181069.1-995s1c1
Sequence:CCGGGCATGATTCAGTCCAAGGAAACTCGAGTTTCCTTGGACTGAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-347s1c1
Sequence:CCGGGCTGATCTTAGGCATCGACTTCTCGAGAAGTCGATGCCTAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-179s1c1
Sequence:CCGGGCAAGCCATTATATAGTGATACTCGAGTATCACTATATAATGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-700s1c1
Sequence:CCGGGTTCCTTGATTTCTCCATGAACTCGAGTTCATGGAGAAATCAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181069.1-358s1c1
Sequence:CCGGGCATCGACTTACAGAAGAAATCTCGAGATTTCTTCTGTAAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks