EMAIL THIS PAGE TO A FRIEND

UGT8

UDP glycosyltransferase 8

Synonyms: CGT UGT4
UniProtKB ID: Q16880, B3KXU7, O00196
Gene ID:
Human(7368) Summary: The protein encoded by this gene belongs to the UDP-glycosyltransferase family. It catalyzes the transfer of galactose to ceramide, a key enzymatic step in the biosynthesis of galactocerebrosides, which are abundant sphingolipids of the myelin membrane of the central and peripheral nervous systems. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
Rat(50555) UDP glycosyltransferase 8
chicken(374033) UDP glycosyltransferase 8
domestic cat(101097722) UDP glycosyltransferase 8
Horse(100072587) UDP glycosyltransferase 8
dog(487910) UDP glycosyltransferase 8
domestic guinea pig(100718939) UDP glycosyltransferase 8
naked mole-rat(101702896) UDP glycosyltransferase 8
cow(281566) UDP glycosyltransferase 8
sheep(101113069) UDP glycosyltransferase 8
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003360 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019091 MISSION® esiRNA esiRNA targeting human UGT8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128174 Rosetta Predictions human pricing
NM_003360 Rosetta Predictions human pricing
NM_019276 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330716 predicted 818
2 SASI_Hs02_00330717 predicted 949
3 SASI_Hs02_00330718 predicted 2069
4 SASI_Hs02_00330719 predicted 1754
5 SASI_Hs02_00330720 predicted 2056
6 SASI_Hs02_00330721 predicted 1790
7 SASI_Hs02_00330722 predicted 801
8 SASI_Hs02_00330723 predicted 1507
9 SASI_Hs02_00330724 predicted 834
10 SASI_Hs02_00330725 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155239 predicted 810
2 SASI_Hs01_00155240 predicted 942
3 SASI_Hs01_00155241 predicted 2055
4 SASI_Hs01_00155242 predicted 1749
5 SASI_Hs01_00155243 predicted 2055
6 SASI_Hs01_00155244 predicted 1790
7 SASI_Hs01_00155245 predicted 797
8 SASI_Hs01_00155247 predicted 1495
9 SASI_Hs01_00155248 predicted 829
10 SASI_Hs02_00335510 predicted 1707
11 SASI_Hs01_00155246 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048466 predicted 1604
2 SASI_Rn01_00048467 predicted 1645
3 SASI_Rn02_00262196 predicted 1718
4 SASI_Rn02_00262197 predicted 1137
5 SASI_Rn01_00048469 predicted 497
6 SASI_Rn01_00048470 predicted 489
7 SASI_Rn01_00048472 predicted 1258
8 SASI_Rn01_00048474 predicted 379
9 SASI_Rn02_00262198 predicted 456
10 SASI_Rn02_00262199 predicted 315
11 SASI_Rn01_00048465 predicted 1730
12 SASI_Rn01_00048468 predicted 1777
13 SASI_Rn01_00048471 predicted 1409
14 SASI_Rn01_00048473 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003360
VALIDATED
UGT8 MISSION shRNA Bacterial Glycerol Stock
UDP glycosyltransferase 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003360.2-1749s1c1
Sequence:CCGGGCACTAGTGAAGGTTATCAATCTCGAGATTGATAACCTTCACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-929s1c1
Sequence:CCGGCCCTAATGATATGTGTGGATTCTCGAGAATCCACACATATCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-813s1c1
Sequence:CCGGGCAATCGAACTGTTTGACATACTCGAGTATGTCAAACAGTTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-1832s1c1
Sequence:CCGGCCCTGTCAATCGAACTATCTACTCGAGTAGATAGTTCGATTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-1553s1c1
Sequence:CCGGGCTTGGGCATTCAAAGATTAACTCGAGTTAATCTTTGAATGCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003360.3-1647s21c1
Sequence:CCGGCACTCTTTGGAGACCATTATGCTCGAGCATAATGGTCTCCAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-1337s21c1
Sequence:CCGGGATCTCCAAAGATGGGTAAATCTCGAGATTTACCCATCTTTGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-726s21c1
Sequence:CCGGAGCGCTACCCAGGGATCTTTACTCGAGTAAAGATCCCTGGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-774s21c1
Sequence:CCGGAGTCCAAGATGCGGAATATTTCTCGAGAAATATTCCGCATCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-2250s21c1
Sequence:CCGGGCCCTTATGAGATCTACTAATCTCGAGATTAGTAGATCTCATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-583s21c1
Sequence:CCGGCATCATCGTGCCGCCAATTATCTCGAGATAATTGGCGGCACGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-1748s21c1
Sequence:CCGGGCACTAGTGAAGGTTATCAATCTCGAGATTGATAACCTTCACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003360
VALIDATED
UGT8 MISSION shRNA shRNA Plasmid DNA
UDP glycosyltransferase 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003360.2-1749s1c1
Sequence:CCGGGCACTAGTGAAGGTTATCAATCTCGAGATTGATAACCTTCACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-929s1c1
Sequence:CCGGCCCTAATGATATGTGTGGATTCTCGAGAATCCACACATATCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-813s1c1
Sequence:CCGGGCAATCGAACTGTTTGACATACTCGAGTATGTCAAACAGTTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-1832s1c1
Sequence:CCGGCCCTGTCAATCGAACTATCTACTCGAGTAGATAGTTCGATTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-1553s1c1
Sequence:CCGGGCTTGGGCATTCAAAGATTAACTCGAGTTAATCTTTGAATGCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003360.3-1647s21c1
Sequence:CCGGCACTCTTTGGAGACCATTATGCTCGAGCATAATGGTCTCCAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-1337s21c1
Sequence:CCGGGATCTCCAAAGATGGGTAAATCTCGAGATTTACCCATCTTTGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-726s21c1
Sequence:CCGGAGCGCTACCCAGGGATCTTTACTCGAGTAAAGATCCCTGGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-774s21c1
Sequence:CCGGAGTCCAAGATGCGGAATATTTCTCGAGAAATATTCCGCATCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-2250s21c1
Sequence:CCGGGCCCTTATGAGATCTACTAATCTCGAGATTAGTAGATCTCATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-583s21c1
Sequence:CCGGCATCATCGTGCCGCCAATTATCTCGAGATAATTGGCGGCACGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-1748s21c1
Sequence:CCGGGCACTAGTGAAGGTTATCAATCTCGAGATTGATAACCTTCACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003360
VALIDATED
UGT8 MISSION shRNA Lentiviral Transduction Particles
UDP glycosyltransferase 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003360.2-1749s1c1
Sequence:CCGGGCACTAGTGAAGGTTATCAATCTCGAGATTGATAACCTTCACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-929s1c1
Sequence:CCGGCCCTAATGATATGTGTGGATTCTCGAGAATCCACACATATCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-813s1c1
Sequence:CCGGGCAATCGAACTGTTTGACATACTCGAGTATGTCAAACAGTTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-1832s1c1
Sequence:CCGGCCCTGTCAATCGAACTATCTACTCGAGTAGATAGTTCGATTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003360.2-1553s1c1
Sequence:CCGGGCTTGGGCATTCAAAGATTAACTCGAGTTAATCTTTGAATGCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003360.3-1647s21c1
Sequence:CCGGCACTCTTTGGAGACCATTATGCTCGAGCATAATGGTCTCCAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-1337s21c1
Sequence:CCGGGATCTCCAAAGATGGGTAAATCTCGAGATTTACCCATCTTTGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-726s21c1
Sequence:CCGGAGCGCTACCCAGGGATCTTTACTCGAGTAAAGATCCCTGGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-774s21c1
Sequence:CCGGAGTCCAAGATGCGGAATATTTCTCGAGAAATATTCCGCATCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-2250s21c1
Sequence:CCGGGCCCTTATGAGATCTACTAATCTCGAGATTAGTAGATCTCATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-583s21c1
Sequence:CCGGCATCATCGTGCCGCCAATTATCTCGAGATAATTGGCGGCACGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003360.3-1748s21c1
Sequence:CCGGGCACTAGTGAAGGTTATCAATCTCGAGATTGATAACCTTCACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks