EMAIL THIS PAGE TO A FRIEND

UHMK1

U2AF homology motif (UHM) kinase 1

Synonyms: KIS KIST P-CIP2
UniProtKB ID: Q8TAS1, A8K8K4, G3V1M1, Q96C22
Gene ID:
Human(127933) Summary: The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and the gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(16589) U2AF homology motif (UHM) kinase 1
Rat(246332) U2AF homology motif (UHM) kinase 1
Zebrafish(767721) U2AF homology motif (UHM) kinase 1
dog(478986) U2AF homology motif (UHM) kinase 1
Horse(100058796) U2AF homology motif (UHM) kinase 1
domestic cat(101085524) U2AF homology motif (UHM) kinase 1
chicken(424369) U2AF homology motif (UHM) kinase 1
cow(538770) U2AF homology motif (UHM) kinase 1
sheep(101109055) U2AF homology motif (UHM) kinase 1
naked mole-rat(101709942) U2AF homology motif (UHM) kinase 1
domestic guinea pig(100720874) U2AF homology motif (UHM) kinase 1
190 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144624 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175866 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175866 Rosetta Predictions human pricing
NM_017293 Rosetta Predictions rat pricing
NM_010633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369141 predicted 1203
2 SASI_Hs01_00073612 predicted 435
3 SASI_Hs01_00073613 predicted 340
4 SASI_Hs01_00073614 predicted 1387
5 SASI_Hs01_00073615 predicted 873
6 SASI_Hs02_00369142 predicted 977
7 SASI_Hs02_00369143 predicted 610
8 SASI_Hs01_00073619 predicted 403
9 SASI_Hs01_00073620 predicted 898
10 SASI_Hs01_00073621 predicted 544
11 SASI_Hs01_00073616 predicted 1025
12 SASI_Hs01_00073617 predicted 1378
13 SASI_Hs01_00073618 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050674 predicted 414
2 SASI_Rn01_00050675 predicted 509
3 SASI_Rn01_00050676 predicted 435
4 SASI_Rn01_00050677 predicted 868
5 SASI_Rn01_00050678 predicted 1410
6 SASI_Rn01_00050679 predicted 458
7 SASI_Rn01_00050680 predicted 1329
8 SASI_Rn01_00050681 predicted 851
9 SASI_Rn01_00050683 predicted 933
10 SASI_Rn02_00261732 predicted 925
11 SASI_Rn01_00050682 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077141 predicted 864
2 SASI_Mm01_00077142 predicted 428
3 SASI_Mm01_00077143 predicted 356
4 SASI_Mm01_00077144 predicted 1321
5 SASI_Mm01_00077146 predicted 920
6 SASI_Mm01_00077147 predicted 1039
7 SASI_Mm01_00077148 predicted 439
8 SASI_Mm01_00077149 predicted 520
9 SASI_Mm01_00077150 predicted 1258
10 SASI_Mm02_00318980 predicted 419
11 SASI_Mm01_00077145 predicted 1128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010633
VALIDATED
UHMK1 MISSION shRNA Bacterial Glycerol Stock
U2AF homology motif (UHM) kinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010633.3-420s1c1
Sequence:CCGGCGTGACTTTATATGGAGTCTTCTCGAGAAGACTCCATATAAAGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-651s1c1
Sequence:CCGGGAGTGCGGAGAATGAGTGTTTCTCGAGAAACACTCATTCTCCGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-1219s1c1
Sequence:CCGGCCAGTGGTTTCTCTGCTTGTTCTCGAGAACAAGCAGAGAAACCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-940s1c1
Sequence:CCGGGCCAGTAAAGCAGTGGTGAATCTCGAGATTCACCACTGCTTTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-976s21c1
Sequence:CCGGTATCACCTCAGAGACCTTATCCTCGAGGATAAGGTCTCTGAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-1219s21c1
Sequence:CCGGCCAGTGGTTTCTCTGCTTGTTCTCGAGAACAAGCAGAGAAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-940s21c1
Sequence:CCGGGCCAGTAAAGCAGTGGTGAATCTCGAGATTCACCACTGCTTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-651s21c1
Sequence:CCGGGAGTGCGGAGAATGAGTGTTTCTCGAGAAACACTCATTCTCCGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010633
VALIDATED
UHMK1 MISSION shRNA shRNA Plasmid DNA
U2AF homology motif (UHM) kinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010633.3-420s1c1
Sequence:CCGGCGTGACTTTATATGGAGTCTTCTCGAGAAGACTCCATATAAAGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-651s1c1
Sequence:CCGGGAGTGCGGAGAATGAGTGTTTCTCGAGAAACACTCATTCTCCGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-1219s1c1
Sequence:CCGGCCAGTGGTTTCTCTGCTTGTTCTCGAGAACAAGCAGAGAAACCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-940s1c1
Sequence:CCGGGCCAGTAAAGCAGTGGTGAATCTCGAGATTCACCACTGCTTTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-976s21c1
Sequence:CCGGTATCACCTCAGAGACCTTATCCTCGAGGATAAGGTCTCTGAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-1219s21c1
Sequence:CCGGCCAGTGGTTTCTCTGCTTGTTCTCGAGAACAAGCAGAGAAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-940s21c1
Sequence:CCGGGCCAGTAAAGCAGTGGTGAATCTCGAGATTCACCACTGCTTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-651s21c1
Sequence:CCGGGAGTGCGGAGAATGAGTGTTTCTCGAGAAACACTCATTCTCCGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010633
VALIDATED
UHMK1 MISSION shRNA Lentiviral Transduction Particles
U2AF homology motif (UHM) kinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010633.3-420s1c1
Sequence:CCGGCGTGACTTTATATGGAGTCTTCTCGAGAAGACTCCATATAAAGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-651s1c1
Sequence:CCGGGAGTGCGGAGAATGAGTGTTTCTCGAGAAACACTCATTCTCCGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-1219s1c1
Sequence:CCGGCCAGTGGTTTCTCTGCTTGTTCTCGAGAACAAGCAGAGAAACCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010633.3-940s1c1
Sequence:CCGGGCCAGTAAAGCAGTGGTGAATCTCGAGATTCACCACTGCTTTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-976s21c1
Sequence:CCGGTATCACCTCAGAGACCTTATCCTCGAGGATAAGGTCTCTGAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-1219s21c1
Sequence:CCGGCCAGTGGTTTCTCTGCTTGTTCTCGAGAACAAGCAGAGAAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-940s21c1
Sequence:CCGGGCCAGTAAAGCAGTGGTGAATCTCGAGATTCACCACTGCTTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010633.3-651s21c1
Sequence:CCGGGAGTGCGGAGAATGAGTGTTTCTCGAGAAACACTCATTCTCCGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144624
VALIDATED
UHMK1 MISSION shRNA Bacterial Glycerol Stock
U2AF homology motif (UHM) kinase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-656s1c1
Sequence:CCGGGAGTGCAGAGAATGAATGTTTCTCGAGAAACATTCATTCTCTGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1131s1c1
Sequence:CCGGCTGCTGAATGTGCTGGATGATCTCGAGATCATCCAGCACATTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1061s1c1
Sequence:CCGGCCCATTCTTTAGCATTCCTTTCTCGAGAAAGGAATGCTAAAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-978s1c1
Sequence:CCGGGCCTATCACCTAAGAGACCTTCTCGAGAAGGTCTCTTAGGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1227s1c1
Sequence:CCGGGAAATTACTGACTGGAAGGATCTCGAGATCCTTCCAGTCAGTAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144624
VALIDATED
UHMK1 MISSION shRNA shRNA Plasmid DNA
U2AF homology motif (UHM) kinase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-656s1c1
Sequence:CCGGGAGTGCAGAGAATGAATGTTTCTCGAGAAACATTCATTCTCTGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1131s1c1
Sequence:CCGGCTGCTGAATGTGCTGGATGATCTCGAGATCATCCAGCACATTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1061s1c1
Sequence:CCGGCCCATTCTTTAGCATTCCTTTCTCGAGAAAGGAATGCTAAAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-978s1c1
Sequence:CCGGGCCTATCACCTAAGAGACCTTCTCGAGAAGGTCTCTTAGGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1227s1c1
Sequence:CCGGGAAATTACTGACTGGAAGGATCTCGAGATCCTTCCAGTCAGTAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144624
VALIDATED
UHMK1 MISSION shRNA Lentiviral Transduction Particles
U2AF homology motif (UHM) kinase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-656s1c1
Sequence:CCGGGAGTGCAGAGAATGAATGTTTCTCGAGAAACATTCATTCTCTGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1131s1c1
Sequence:CCGGCTGCTGAATGTGCTGGATGATCTCGAGATCATCCAGCACATTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1061s1c1
Sequence:CCGGCCCATTCTTTAGCATTCCTTTCTCGAGAAAGGAATGCTAAAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-978s1c1
Sequence:CCGGGCCTATCACCTAAGAGACCTTCTCGAGAAGGTCTCTTAGGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144624.x-1227s1c1
Sequence:CCGGGAAATTACTGACTGGAAGGATCTCGAGATCCTTCCAGTCAGTAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175866
VALIDATED
UHMK1 MISSION shRNA Bacterial Glycerol Stock
U2AF homology motif (UHM) kinase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-1262s1c1
Sequence:CCGGGTATGCAAATGCTGGTGATTCCTCGAGGAATCACCAGCATTTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-489s1c1
Sequence:CCGGGTTTCGGAATTGCTCTTATATCTCGAGATATAAGAGCAATTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175866.2-912s1c1
Sequence:CCGGGATCACATATTTGCCAGTAAACTCGAGTTTACTGGCAAATATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-1209s1c1
Sequence:CCGGGTATCTCTACTTGTTCCAAAGCTCGAGCTTTGGAACAAGTAGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1039s21c1
Sequence:CCGGCCCATTCTTTAGCATTCCTTTCTCGAGAAAGGAATGCTAAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-956s21c1
Sequence:CCGGGCCTATCACCTAAGAGACCTTCTCGAGAAGGTCTCTTAGGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1109s21c1
Sequence:CCGGCTGCTGAATGTGCTGGATGATCTCGAGATCATCCAGCACATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1294s21c1
Sequence:CCGGGAAATTACTGACTGGAAGGATCTCGAGATCCTTCCAGTCAGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-634s21c1
Sequence:CCGGGAGTGCAGAGAATGAATGTTTCTCGAGAAACATTCATTCTCTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175866
VALIDATED
UHMK1 MISSION shRNA shRNA Plasmid DNA
U2AF homology motif (UHM) kinase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-1262s1c1
Sequence:CCGGGTATGCAAATGCTGGTGATTCCTCGAGGAATCACCAGCATTTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-489s1c1
Sequence:CCGGGTTTCGGAATTGCTCTTATATCTCGAGATATAAGAGCAATTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175866.2-912s1c1
Sequence:CCGGGATCACATATTTGCCAGTAAACTCGAGTTTACTGGCAAATATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-1209s1c1
Sequence:CCGGGTATCTCTACTTGTTCCAAAGCTCGAGCTTTGGAACAAGTAGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1039s21c1
Sequence:CCGGCCCATTCTTTAGCATTCCTTTCTCGAGAAAGGAATGCTAAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-956s21c1
Sequence:CCGGGCCTATCACCTAAGAGACCTTCTCGAGAAGGTCTCTTAGGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1109s21c1
Sequence:CCGGCTGCTGAATGTGCTGGATGATCTCGAGATCATCCAGCACATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1294s21c1
Sequence:CCGGGAAATTACTGACTGGAAGGATCTCGAGATCCTTCCAGTCAGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-634s21c1
Sequence:CCGGGAGTGCAGAGAATGAATGTTTCTCGAGAAACATTCATTCTCTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175866
VALIDATED
UHMK1 MISSION shRNA Lentiviral Transduction Particles
U2AF homology motif (UHM) kinase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-1262s1c1
Sequence:CCGGGTATGCAAATGCTGGTGATTCCTCGAGGAATCACCAGCATTTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-489s1c1
Sequence:CCGGGTTTCGGAATTGCTCTTATATCTCGAGATATAAGAGCAATTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175866.2-912s1c1
Sequence:CCGGGATCACATATTTGCCAGTAAACTCGAGTTTACTGGCAAATATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175866.2-1209s1c1
Sequence:CCGGGTATCTCTACTTGTTCCAAAGCTCGAGCTTTGGAACAAGTAGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1039s21c1
Sequence:CCGGCCCATTCTTTAGCATTCCTTTCTCGAGAAAGGAATGCTAAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-956s21c1
Sequence:CCGGGCCTATCACCTAAGAGACCTTCTCGAGAAGGTCTCTTAGGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1109s21c1
Sequence:CCGGCTGCTGAATGTGCTGGATGATCTCGAGATCATCCAGCACATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-1294s21c1
Sequence:CCGGGAAATTACTGACTGGAAGGATCTCGAGATCCTTCCAGTCAGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175866.3-634s21c1
Sequence:CCGGGAGTGCAGAGAATGAATGTTTCTCGAGAAACATTCATTCTCTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks