EMAIL THIS PAGE TO A FRIEND

UHRF1

ubiquitin-like with PHD and ring finger domains 1

Synonyms: ICBP90 Np95 RNF106 hNP95 hUHRF1
Gene ID:
Human(29128) Summary: This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18140) ubiquitin-like, containing PHD and RING finger domains, 1
Rat(316129) ubiquitin-like with PHD and ring finger domains 1
domestic guinea pig(100719542) ubiquitin-like with PHD and ring finger domains 1
naked mole-rat(101719703) ubiquitin-like with PHD and ring finger domains 1
cow(530411) ubiquitin-like with PHD and ring finger domains 1
sheep(101113067) ubiquitin-like with PHD and ring finger domains 1
Zebrafish(406350) ubiquitin-like, containing PHD and RING finger domains, 1
Horse(100062347) ubiquitin-like with PHD and ring finger domains 1
domestic cat(101083658) ubiquitin-like with PHD and ring finger domains 1
dog(611463) ubiquitin-like with PHD and ring finger domains 1
Zebrafish(100538017) ubiquitin-like with PHD and ring finger domains 1
chicken(420154) ubiquitin-like with PHD and ring finger domains 1
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013282 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048201 Rosetta Predictions human pricing
NM_013282 Rosetta Predictions human pricing
NM_001008882 Rosetta Predictions rat pricing
NM_001111078 Rosetta Predictions mouse pricing
NM_001111079 Rosetta Predictions mouse pricing
NM_001111080 Rosetta Predictions mouse pricing
NM_010931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311672 predicted 1169
2 SASI_Hs02_00311673 predicted 2298
3 SASI_Hs02_00311674 predicted 982
4 SASI_Hs02_00311675 predicted 1152
5 SASI_Hs02_00311676 predicted 533
6 SASI_Hs02_00311677 predicted 1506
7 SASI_Hs02_00311678 predicted 1609
8 SASI_Hs02_00311679 predicted 1650
9 SASI_Hs02_00311680 predicted 824
10 SASI_Hs02_00311681 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344542 predicted 1333
2 SASI_Hs02_00344543 predicted 2458
3 SASI_Hs02_00344544 predicted 1150
4 SASI_Hs02_00344545 predicted 1312
5 SASI_Hs02_00344546 predicted 700
6 SASI_Hs02_00344547 predicted 1666
7 SASI_Hs02_00344548 predicted 1778
8 SASI_Hs01_00165591 predicted 1817
9 SASI_Hs02_00344549 predicted 989
10 SASI_Hs02_00344550 predicted 1834
11 SASI_Hs01_00165586 predicted 1751
12 SASI_Hs01_00165587 predicted 1612
13 SASI_Hs01_00165588 predicted 1795
14 SASI_Hs01_00165589 predicted 2887
15 SASI_Hs01_00165590 predicted 1758
16 SASI_Hs01_00165592 predicted 485
17 SASI_Hs01_00165593 predicted 1530
18 SASI_Hs01_00165594 predicted 1552
19 SASI_Hs01_00165595 predicted 2168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070270 predicted 991
2 SASI_Rn02_00199426 predicted 2086
3 SASI_Rn01_00070272 predicted 899
4 SASI_Rn01_00070273 predicted 1862
5 SASI_Rn01_00070274 predicted 1683
6 SASI_Rn01_00070275 predicted 988
7 SASI_Rn01_00070276 predicted 1903
8 SASI_Rn01_00070277 predicted 617
9 SASI_Rn02_00199427 predicted 1120
10 SASI_Rn02_00199428 predicted 1524
11 SASI_Rn01_00070271 predicted 588
12 SASI_Rn01_00070278 predicted 1802
13 SASI_Rn01_00070279 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306345 predicted 475
2 SASI_Mm02_00306346 predicted 513
3 SASI_Mm02_00306347 predicted 618
4 SASI_Mm02_00306348 predicted 621
5 SASI_Mm02_00306349 predicted 665
6 SASI_Mm02_00306350 predicted 631
7 SASI_Mm02_00306351 predicted 402
8 SASI_Mm02_00306352 predicted 597
9 SASI_Mm02_00306353 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306354 predicted 624
2 SASI_Mm02_00306355 predicted 655
3 SASI_Mm02_00306356 predicted 758
4 SASI_Mm02_00306357 predicted 766
5 SASI_Mm02_00306358 predicted 812
6 SASI_Mm02_00306359 predicted 769
7 SASI_Mm02_00306360 predicted 547
8 SASI_Mm02_00306361 predicted 745
9 SASI_Mm02_00306362 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306363 predicted 479
2 SASI_Mm02_00306364 predicted 507
3 SASI_Mm02_00306365 predicted 621
4 SASI_Mm02_00306366 predicted 623
5 SASI_Mm02_00306367 predicted 664
6 SASI_Mm02_00306368 predicted 628
7 SASI_Mm02_00306369 predicted 394
8 SASI_Mm02_00306370 predicted 597
9 SASI_Mm02_00306371 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319680 predicted 623
2 SASI_Mm01_00199286 predicted 648
3 SASI_Mm01_00199287 predicted 757
4 SASI_Mm01_00199288 predicted 767
5 SASI_Mm01_00199289 predicted 805
6 SASI_Mm02_00319681 predicted 777
7 SASI_Mm02_00319682 predicted 541
8 SASI_Mm02_00319683 predicted 741
9 SASI_Mm02_00319684 predicted 520
10 SASI_Mm01_00199290 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010931
VALIDATED
UHRF1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like with PHD and ring finger domains 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-732s21c1
Sequence:CCGGCTGTAGCTCCAGTGCCGTTAACTCGAGTTAACGGCACTGGAGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-770s21c1
Sequence:CCGGTCATGTACCATGTCAAGTATGCTCGAGCATACTTGACATGGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-403s21c1
Sequence:CCGGCACACACTCTTCGATTATGATCTCGAGATCATAATCGAAGAGTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-887s21c1
Sequence:CCGGAGGTGGTCATGGCCAACTATACTCGAGTATAGTTGGCCATGACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-806s21c1
Sequence:CCGGATGGAGTGGACATTGTCAAAGCTCGAGCTTTGACAATGTCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010931.2-342s1c1
Sequence:CCGGCGATTATGATGTGCGCCTCAACTCGAGTTGAGGCGCACATCATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-331s1c1
Sequence:CCGGCACACACTCTTCGATTATGATCTCGAGATCATAATCGAAGAGTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-909s1c1
Sequence:CCGGACGTGAGCTATACGGCAACATCTCGAGATGTTGCCGTATAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-583s1c1
Sequence:CCGGCGTGACAATATCTTCGGTGCACTCGAGTGCACCGAAGATATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010931.2-964s1c1
Sequence:CCGGCGGATCATGTTTGTGGATGAACTCGAGTTCATCCACAAACATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010931
VALIDATED
UHRF1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like with PHD and ring finger domains 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-732s21c1
Sequence:CCGGCTGTAGCTCCAGTGCCGTTAACTCGAGTTAACGGCACTGGAGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-770s21c1
Sequence:CCGGTCATGTACCATGTCAAGTATGCTCGAGCATACTTGACATGGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-403s21c1
Sequence:CCGGCACACACTCTTCGATTATGATCTCGAGATCATAATCGAAGAGTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-887s21c1
Sequence:CCGGAGGTGGTCATGGCCAACTATACTCGAGTATAGTTGGCCATGACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-806s21c1
Sequence:CCGGATGGAGTGGACATTGTCAAAGCTCGAGCTTTGACAATGTCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010931.2-342s1c1
Sequence:CCGGCGATTATGATGTGCGCCTCAACTCGAGTTGAGGCGCACATCATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-331s1c1
Sequence:CCGGCACACACTCTTCGATTATGATCTCGAGATCATAATCGAAGAGTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-909s1c1
Sequence:CCGGACGTGAGCTATACGGCAACATCTCGAGATGTTGCCGTATAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-583s1c1
Sequence:CCGGCGTGACAATATCTTCGGTGCACTCGAGTGCACCGAAGATATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010931.2-964s1c1
Sequence:CCGGCGGATCATGTTTGTGGATGAACTCGAGTTCATCCACAAACATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010931
VALIDATED
UHRF1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like with PHD and ring finger domains 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-732s21c1
Sequence:CCGGCTGTAGCTCCAGTGCCGTTAACTCGAGTTAACGGCACTGGAGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-770s21c1
Sequence:CCGGTCATGTACCATGTCAAGTATGCTCGAGCATACTTGACATGGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-403s21c1
Sequence:CCGGCACACACTCTTCGATTATGATCTCGAGATCATAATCGAAGAGTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-887s21c1
Sequence:CCGGAGGTGGTCATGGCCAACTATACTCGAGTATAGTTGGCCATGACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010931.3-806s21c1
Sequence:CCGGATGGAGTGGACATTGTCAAAGCTCGAGCTTTGACAATGTCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010931.2-342s1c1
Sequence:CCGGCGATTATGATGTGCGCCTCAACTCGAGTTGAGGCGCACATCATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-331s1c1
Sequence:CCGGCACACACTCTTCGATTATGATCTCGAGATCATAATCGAAGAGTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-909s1c1
Sequence:CCGGACGTGAGCTATACGGCAACATCTCGAGATGTTGCCGTATAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010931.2-583s1c1
Sequence:CCGGCGTGACAATATCTTCGGTGCACTCGAGTGCACCGAAGATATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010931.2-964s1c1
Sequence:CCGGCGGATCATGTTTGTGGATGAACTCGAGTTCATCCACAAACATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013282
VALIDATED
UHRF1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like with PHD and ring finger domains 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-875s21c1
Sequence:CCGGCGTCATTTACCACGTGAAATACTCGAGTATTTCACGTGGTAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-1851s21c1
Sequence:CCGGGCGCTGGCTCTCAACTGCTTTCTCGAGAAAGCAGTTGAGAGCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013282.3-1547s21c1
Sequence:CCGGCCGCACCAAGGAATGTACCATCTCGAGATGGTACATTCCTTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-3485s21c1
Sequence:CCGGGCCTTTGATTCGTTCCTTCTTCTCGAGAAGAAGGAACGAATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-708s21c1
Sequence:CCGGATGTGGGATGAGACGGAATTGCTCGAGCAATTCCGTCTCATCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013282.x-1299s1c1
Sequence:CCGGCCGCACCAAGGAATGTACCATCTCGAGATGGTACATTCCTTGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013282.x-1767s1c1
Sequence:CCGGTGTGAAATACTGGCCCGAGAACTCGAGTTCTCGGGCCAGTATTTCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013282.x-1603s1c1
Sequence:CCGGGCGCTGGCTCTCAACTGCTTTCTCGAGAAAGCAGTTGAGAGCCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013282.x-1896s1c1
Sequence:CCGGCATGCAGTATCCAGAAGGCTACTCGAGTAGCCTTCTGGATACTGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013282.x-3235s1c1
Sequence:CCGGGCCTTTGATTCGTTCCTTCTTCTCGAGAAGAAGGAACGAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013282
VALIDATED
UHRF1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like with PHD and ring finger domains 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-875s21c1
Sequence:CCGGCGTCATTTACCACGTGAAATACTCGAGTATTTCACGTGGTAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-1851s21c1
Sequence:CCGGGCGCTGGCTCTCAACTGCTTTCTCGAGAAAGCAGTTGAGAGCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013282.3-1547s21c1
Sequence:CCGGCCGCACCAAGGAATGTACCATCTCGAGATGGTACATTCCTTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-3485s21c1
Sequence:CCGGGCCTTTGATTCGTTCCTTCTTCTCGAGAAGAAGGAACGAATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-708s21c1
Sequence:CCGGATGTGGGATGAGACGGAATTGCTCGAGCAATTCCGTCTCATCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013282.x-1299s1c1
Sequence:CCGGCCGCACCAAGGAATGTACCATCTCGAGATGGTACATTCCTTGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013282.x-1767s1c1
Sequence:CCGGTGTGAAATACTGGCCCGAGAACTCGAGTTCTCGGGCCAGTATTTCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013282.x-1603s1c1
Sequence:CCGGGCGCTGGCTCTCAACTGCTTTCTCGAGAAAGCAGTTGAGAGCCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013282.x-1896s1c1
Sequence:CCGGCATGCAGTATCCAGAAGGCTACTCGAGTAGCCTTCTGGATACTGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013282.x-3235s1c1
Sequence:CCGGGCCTTTGATTCGTTCCTTCTTCTCGAGAAGAAGGAACGAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013282
VALIDATED
UHRF1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like with PHD and ring finger domains 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-875s21c1
Sequence:CCGGCGTCATTTACCACGTGAAATACTCGAGTATTTCACGTGGTAAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-1851s21c1
Sequence:CCGGGCGCTGGCTCTCAACTGCTTTCTCGAGAAAGCAGTTGAGAGCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013282.3-1547s21c1
Sequence:CCGGCCGCACCAAGGAATGTACCATCTCGAGATGGTACATTCCTTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-3485s21c1
Sequence:CCGGGCCTTTGATTCGTTCCTTCTTCTCGAGAAGAAGGAACGAATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013282.3-708s21c1
Sequence:CCGGATGTGGGATGAGACGGAATTGCTCGAGCAATTCCGTCTCATCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013282.x-1299s1c1
Sequence:CCGGCCGCACCAAGGAATGTACCATCTCGAGATGGTACATTCCTTGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013282.x-1767s1c1
Sequence:CCGGTGTGAAATACTGGCCCGAGAACTCGAGTTCTCGGGCCAGTATTTCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013282.x-1603s1c1
Sequence:CCGGGCGCTGGCTCTCAACTGCTTTCTCGAGAAAGCAGTTGAGAGCCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013282.x-1896s1c1
Sequence:CCGGCATGCAGTATCCAGAAGGCTACTCGAGTAGCCTTCTGGATACTGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013282.x-3235s1c1
Sequence:CCGGGCCTTTGATTCGTTCCTTCTTCTCGAGAAGAAGGAACGAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks