EMAIL THIS PAGE TO A FRIEND

UHRF1BP1

UHRF1 binding protein 1

Synonyms: C6orf107 ICBP90 dJ349A12.1
UniProtKB ID: Q6BDS2, Q9NXE0
Gene ID:
Mouse(224648) UHRF1 (ICBP90) binding protein 1
Rat(309637) UHRF1 binding protein 1
Zebrafish(567346) UHRF1 binding protein 1
chicken(419900) UHRF1 binding protein 1
domestic cat(101089266) UHRF1 binding protein 1
Horse(100062838) UHRF1 binding protein 1
dog(481752) UHRF1 binding protein 1
cow(534225) UHRF1 binding protein 1
sheep(101120704) UHRF1 binding protein 1
naked mole-rat(101696851) UHRF1 binding protein 1
Domestic Rabbit(100358010) UHRF1 binding protein 1
domestic guinea pig(100732592) UHRF1 binding protein 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017754 Rosetta Predictions human pricing
XM_228025 Rosetta Predictions rat pricing
NM_001080769 Rosetta Predictions mouse pricing
XM_915447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055742 predicted 4333
2 SASI_Hs02_00350568 predicted 1700
3 SASI_Hs01_00055743 predicted 2779
4 SASI_Hs01_00055744 predicted 842
5 SASI_Hs01_00055745 predicted 3616
6 SASI_Hs01_00055746 predicted 2827
7 SASI_Hs01_00055747 predicted 4068
8 SASI_Hs01_00055750 predicted 1756
9 SASI_Hs01_00055751 predicted 2635
10 SASI_Hs02_00350569 predicted 1977
11 SASI_Hs01_00055748 predicted 2678
12 SASI_Hs01_00055749 predicted 1837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156851 predicted 4578
2 SASI_Rn01_00156852 predicted 3754
3 SASI_Rn01_00156853 predicted 2698
4 SASI_Rn01_00156854 predicted 1679
5 SASI_Rn01_00156855 predicted 3716
6 SASI_Rn01_00156856 predicted 3970
7 SASI_Rn01_00156857 predicted 1657
8 SASI_Rn01_00156858 predicted 1565
9 SASI_Rn01_00156859 predicted 1137
10 SASI_Rn01_00156860 predicted 3817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293673 predicted 1841
2 SASI_Mm02_00293674 predicted 2924
3 SASI_Mm02_00293675 predicted 3818
4 SASI_Mm02_00293676 predicted 1047
5 SASI_Mm02_00293677 predicted 4244
6 SASI_Mm02_00293678 predicted 921
7 SASI_Mm02_00293679 predicted 3784
8 SASI_Mm02_00293680 predicted 1818
9 SASI_Mm02_00293681 predicted 3940
10 SASI_Mm02_00293682 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208546 predicted 2089
2 SASI_Mm01_00208547 predicted 3086
3 SASI_Mm01_00208548 predicted 3988
4 SASI_Mm01_00208549 predicted 2822
5 SASI_Mm01_00208550 predicted 1221
6 SASI_Mm01_00208551 predicted 4417
7 SASI_Mm01_00208552 predicted 3950
8 SASI_Mm01_00208553 predicted 1983
9 SASI_Mm01_00208554 predicted 4107
10 SASI_Mm01_00208555 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017754
VALIDATED
UHRF1BP1 MISSION shRNA Bacterial Glycerol Stock
UHRF1 binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-2938s1c1
Sequence:CCGGGCCTCGTAGATTCAGAGCTATCTCGAGATAGCTCTGAATCTACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-1916s1c1
Sequence:CCGGGCAGTTCAAAGCTATCTACAACTCGAGTTGTAGATAGCTTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-1350s1c1
Sequence:CCGGGCAGGTGATAGCTGCAAACATCTCGAGATGTTTGCAGCTATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-3591s1c1
Sequence:CCGGCGGATTTCAGTGGACAGTGATCTCGAGATCACTGTCCACTGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-274s1c1
Sequence:CCGGCCCGGTTCACTAAGAATCTTTCTCGAGAAAGATTCTTAGTGAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-456s21c1
Sequence:CCGGGTTGAAGACACACCCTATTTGCTCGAGCAAATAGGGTGTGTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-2168s21c1
Sequence:CCGGATTCCAATTATGATCACTTTCCTCGAGGAAAGTGATCATAATTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017754.3-4797s21c1
Sequence:CCGGATCATGTCTTGCCTGTATAAACTCGAGTTTATACAGGCAAGACATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-4341s21c1
Sequence:CCGGACCATCAGCTGAAGTACTTAACTCGAGTTAAGTACTTCAGCTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017754.3-4739s21c1
Sequence:CCGGAGGGCAAAGCATGATTGTATCCTCGAGGATACAATCATGCTTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017754
VALIDATED
UHRF1BP1 MISSION shRNA shRNA Plasmid DNA
UHRF1 binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-2938s1c1
Sequence:CCGGGCCTCGTAGATTCAGAGCTATCTCGAGATAGCTCTGAATCTACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-1916s1c1
Sequence:CCGGGCAGTTCAAAGCTATCTACAACTCGAGTTGTAGATAGCTTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-1350s1c1
Sequence:CCGGGCAGGTGATAGCTGCAAACATCTCGAGATGTTTGCAGCTATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-3591s1c1
Sequence:CCGGCGGATTTCAGTGGACAGTGATCTCGAGATCACTGTCCACTGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-274s1c1
Sequence:CCGGCCCGGTTCACTAAGAATCTTTCTCGAGAAAGATTCTTAGTGAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-456s21c1
Sequence:CCGGGTTGAAGACACACCCTATTTGCTCGAGCAAATAGGGTGTGTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-2168s21c1
Sequence:CCGGATTCCAATTATGATCACTTTCCTCGAGGAAAGTGATCATAATTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017754.3-4797s21c1
Sequence:CCGGATCATGTCTTGCCTGTATAAACTCGAGTTTATACAGGCAAGACATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-4341s21c1
Sequence:CCGGACCATCAGCTGAAGTACTTAACTCGAGTTAAGTACTTCAGCTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017754.3-4739s21c1
Sequence:CCGGAGGGCAAAGCATGATTGTATCCTCGAGGATACAATCATGCTTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017754
VALIDATED
UHRF1BP1 MISSION shRNA Lentiviral Transduction Particles
UHRF1 binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-2938s1c1
Sequence:CCGGGCCTCGTAGATTCAGAGCTATCTCGAGATAGCTCTGAATCTACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-1916s1c1
Sequence:CCGGGCAGTTCAAAGCTATCTACAACTCGAGTTGTAGATAGCTTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-1350s1c1
Sequence:CCGGGCAGGTGATAGCTGCAAACATCTCGAGATGTTTGCAGCTATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-3591s1c1
Sequence:CCGGCGGATTTCAGTGGACAGTGATCTCGAGATCACTGTCCACTGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017754.2-274s1c1
Sequence:CCGGCCCGGTTCACTAAGAATCTTTCTCGAGAAAGATTCTTAGTGAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-456s21c1
Sequence:CCGGGTTGAAGACACACCCTATTTGCTCGAGCAAATAGGGTGTGTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-2168s21c1
Sequence:CCGGATTCCAATTATGATCACTTTCCTCGAGGAAAGTGATCATAATTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017754.3-4797s21c1
Sequence:CCGGATCATGTCTTGCCTGTATAAACTCGAGTTTATACAGGCAAGACATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017754.3-4341s21c1
Sequence:CCGGACCATCAGCTGAAGTACTTAACTCGAGTTAAGTACTTCAGCTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017754.3-4739s21c1
Sequence:CCGGAGGGCAAAGCATGATTGTATCCTCGAGGATACAATCATGCTTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080769
VALIDATED
UHRF1BP1 MISSION shRNA Bacterial Glycerol Stock
UHRF1 binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-6810s21c1
Sequence:CCGGAGGATCACTTGAATTAGTTTACTCGAGTAAACTAATTCAAGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-2172s21c1
Sequence:CCGGGTTGTAGCTACGGTCACTTTCCTCGAGGAAAGTGACCGTAGCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080769.1-1921s21c1
Sequence:CCGGGCAGTTTAAAGCCATCTATAACTCGAGTTATAGATGGCTTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080769.1-278s21c1
Sequence:CCGGCATCTGTCCCGGTTCACTAAGCTCGAGCTTAGTGAACCGGGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-3799s21c1
Sequence:CCGGCTTGAAGGTGAACGAAGTATCCTCGAGGATACTTCGTTCACCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080769
VALIDATED
UHRF1BP1 MISSION shRNA shRNA Plasmid DNA
UHRF1 binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-6810s21c1
Sequence:CCGGAGGATCACTTGAATTAGTTTACTCGAGTAAACTAATTCAAGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-2172s21c1
Sequence:CCGGGTTGTAGCTACGGTCACTTTCCTCGAGGAAAGTGACCGTAGCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080769.1-1921s21c1
Sequence:CCGGGCAGTTTAAAGCCATCTATAACTCGAGTTATAGATGGCTTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080769.1-278s21c1
Sequence:CCGGCATCTGTCCCGGTTCACTAAGCTCGAGCTTAGTGAACCGGGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-3799s21c1
Sequence:CCGGCTTGAAGGTGAACGAAGTATCCTCGAGGATACTTCGTTCACCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080769
VALIDATED
UHRF1BP1 MISSION shRNA Lentiviral Transduction Particles
UHRF1 binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-6810s21c1
Sequence:CCGGAGGATCACTTGAATTAGTTTACTCGAGTAAACTAATTCAAGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-2172s21c1
Sequence:CCGGGTTGTAGCTACGGTCACTTTCCTCGAGGAAAGTGACCGTAGCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080769.1-1921s21c1
Sequence:CCGGGCAGTTTAAAGCCATCTATAACTCGAGTTATAGATGGCTTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080769.1-278s21c1
Sequence:CCGGCATCTGTCCCGGTTCACTAAGCTCGAGCTTAGTGAACCGGGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001080769.1-3799s21c1
Sequence:CCGGCTTGAAGGTGAACGAAGTATCCTCGAGGATACTTCGTTCACCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks