EMAIL THIS PAGE TO A FRIEND

UHRF1BP1L

UHRF1 binding protein 1-like

Synonyms: SHIP164
Gene ID:
Mouse(75089) UHRF1 (ICBP90) binding protein 1-like
Rat(363009) UHRF1 binding protein 1-like
domestic guinea pig(100720642) UHRF1 binding protein 1-like
naked mole-rat(101706347) UHRF1 binding protein 1-like
cow(520720) UHRF1 binding protein 1-like
sheep(101104223) UHRF1 binding protein 1-like
Zebrafish(562208) UHRF1 (ICBP90) binding protein 1-like
chicken(417929) UHRF1 binding protein 1-like
Horse(100066380) UHRF1 binding protein 1-like
domestic cat(101101648) UHRF1 binding protein 1-like
dog(475438) UHRF1 binding protein 1-like
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015054 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006947 Rosetta Predictions human pricing
NM_015054 Rosetta Predictions human pricing
NM_001108753 Rosetta Predictions rat pricing
NM_029166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092257 predicted 1289
2 SASI_Hs01_00092258 predicted 1342
3 SASI_Hs01_00092259 predicted 1441
4 SASI_Hs01_00092260 predicted 1092
5 SASI_Hs01_00092261 predicted 1543
6 SASI_Hs01_00092262 predicted 1444
7 SASI_Hs01_00092263 predicted 1129
8 SASI_Hs01_00092264 predicted 1110
9 SASI_Hs02_00305166 predicted 1110
10 SASI_Hs01_00092265 predicted 386
11 SASI_Hs01_00092266 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167215 predicted 1294
2 SASI_Hs01_00167216 predicted 1337
3 SASI_Hs01_00167217 predicted 1438
4 SASI_Hs01_00167218 predicted 1093
5 SASI_Hs01_00167219 predicted 1536
6 SASI_Hs01_00167220 predicted 1451
7 SASI_Hs01_00167221 predicted 1132
8 SASI_Hs01_00167222 predicted 1111
9 SASI_Hs02_00346903 predicted 1107
10 SASI_Hs01_00167223 predicted 378
11 SASI_Hs01_00167224 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241745 predicted 1459
2 SASI_Rn02_00241746 predicted 1917
3 SASI_Rn02_00241747 predicted 2212
4 SASI_Rn02_00241748 predicted 3286
5 SASI_Rn02_00241749 predicted 1598
6 SASI_Rn02_00241750 predicted 1850
7 SASI_Rn02_00241751 predicted 862
8 SASI_Rn02_00241752 predicted 1422
9 SASI_Rn02_00241753 predicted 4650
10 SASI_Rn02_00241754 predicted 2500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181949 predicted 2660
2 SASI_Mm01_00181950 predicted 4117
3 SASI_Mm01_00181952 predicted 2185
4 SASI_Mm01_00181953 predicted 3310
5 SASI_Mm01_00181954 predicted 2442
6 SASI_Mm01_00181955 predicted 4045
7 SASI_Mm02_00334974 predicted 933
8 SASI_Mm01_00181956 predicted 3109
9 SASI_Mm02_00334975 predicted 986
10 SASI_Mm01_00181958 predicted 1547
11 SASI_Mm01_00181951 predicted 1302
12 SASI_Mm01_00181957 predicted 937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029166
VALIDATED
UHRF1BP1L MISSION shRNA Bacterial Glycerol Stock
UHRF1 binding protein 1-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-830s21c1
Sequence:CCGGGTGCTCCTGTTCGATTAATAACTCGAGTTATTAATCGAACAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-4629s21c1
Sequence:CCGGGAGAAGGACGGCTAGGTTTAACTCGAGTTAAACCTAGCCGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-1434s21c1
Sequence:CCGGGGCCATGAAGGACCGTAATTTCTCGAGAAATTACGGTCCTTCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-2957s21c1
Sequence:CCGGGTAGTGGTATACACCGAATTACTCGAGTAATTCGGTGTATACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029166.1-4652s1c1
Sequence:CCGGGAAGGATGTAACCAGTTAGTGCTCGAGCACTAACTGGTTACATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-1936s21c1
Sequence:CCGGATCCGAGTTGACGGCTTAATGCTCGAGCATTAAGCCGTCAACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029166.1-4047s1c1
Sequence:CCGGCCAATGCCACATTGAGAACTTCTCGAGAAGTTCTCAATGTGGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029166
VALIDATED
UHRF1BP1L MISSION shRNA shRNA Plasmid DNA
UHRF1 binding protein 1-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-830s21c1
Sequence:CCGGGTGCTCCTGTTCGATTAATAACTCGAGTTATTAATCGAACAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-4629s21c1
Sequence:CCGGGAGAAGGACGGCTAGGTTTAACTCGAGTTAAACCTAGCCGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-1434s21c1
Sequence:CCGGGGCCATGAAGGACCGTAATTTCTCGAGAAATTACGGTCCTTCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-2957s21c1
Sequence:CCGGGTAGTGGTATACACCGAATTACTCGAGTAATTCGGTGTATACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029166.1-4652s1c1
Sequence:CCGGGAAGGATGTAACCAGTTAGTGCTCGAGCACTAACTGGTTACATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-1936s21c1
Sequence:CCGGATCCGAGTTGACGGCTTAATGCTCGAGCATTAAGCCGTCAACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029166.1-4047s1c1
Sequence:CCGGCCAATGCCACATTGAGAACTTCTCGAGAAGTTCTCAATGTGGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029166
VALIDATED
UHRF1BP1L MISSION shRNA Lentiviral Transduction Particles
UHRF1 binding protein 1-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-830s21c1
Sequence:CCGGGTGCTCCTGTTCGATTAATAACTCGAGTTATTAATCGAACAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-4629s21c1
Sequence:CCGGGAGAAGGACGGCTAGGTTTAACTCGAGTTAAACCTAGCCGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-1434s21c1
Sequence:CCGGGGCCATGAAGGACCGTAATTTCTCGAGAAATTACGGTCCTTCATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-2957s21c1
Sequence:CCGGGTAGTGGTATACACCGAATTACTCGAGTAATTCGGTGTATACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029166.1-4652s1c1
Sequence:CCGGGAAGGATGTAACCAGTTAGTGCTCGAGCACTAACTGGTTACATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029166.1-1936s21c1
Sequence:CCGGATCCGAGTTGACGGCTTAATGCTCGAGCATTAAGCCGTCAACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029166.1-4047s1c1
Sequence:CCGGCCAATGCCACATTGAGAACTTCTCGAGAAGTTCTCAATGTGGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015054
UHRF1BP1L MISSION shRNA Bacterial Glycerol Stock
UHRF1 binding protein 1-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015054.1-4654s1c1
Sequence:CCGGGCTCTGGAGTAGGAAGGTTATCTCGAGATAACCTTCCTACTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-2912s1c1
Sequence:CCGGCCTGATTATTTGCCTACAGAACTCGAGTTCTGTAGGCAAATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-4022s1c1
Sequence:CCGGGCTGTAATACACTCTTTACTTCTCGAGAAGTAAAGAGTGTATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-3916s1c1
Sequence:CCGGCCTTCGGCATTACCTTTGTAACTCGAGTTACAAAGGTAATGCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015054.1-4971s1c1
Sequence:CCGGCCTCTTGTGTTCACACAGATTCTCGAGAATCTGTGTGAACACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-4450s1c1
Sequence:CCGGGCCTTCTCAGTCAGCTAACTTCTCGAGAAGTTAGCTGACTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-2783s1c1
Sequence:CCGGCCTGCTAGTCAGACATCCATTCTCGAGAATGGATGTCTGACTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-262s1c1
Sequence:CCGGGCACCTCTCCAGATTTACCAACTCGAGTTGGTAAATCTGGAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-4214s1c1
Sequence:CCGGCGGAGTAGTACAGTATCCCTTCTCGAGAAGGGATACTGTACTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015054.1-4782s1c1
Sequence:CCGGGAAAGTATTAGTACGGGCATTCTCGAGAATGCCCGTACTAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-1182s1c1
Sequence:CCGGCCTCCCATCATTTAGTGATTTCTCGAGAAATCACTAAATGATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-2636s1c1
Sequence:CCGGGCAGATATTCATCTCCTAGTTCTCGAGAACTAGGAGATGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015054
UHRF1BP1L MISSION shRNA shRNA Plasmid DNA
UHRF1 binding protein 1-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015054.1-4654s1c1
Sequence:CCGGGCTCTGGAGTAGGAAGGTTATCTCGAGATAACCTTCCTACTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-2912s1c1
Sequence:CCGGCCTGATTATTTGCCTACAGAACTCGAGTTCTGTAGGCAAATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-4022s1c1
Sequence:CCGGGCTGTAATACACTCTTTACTTCTCGAGAAGTAAAGAGTGTATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-3916s1c1
Sequence:CCGGCCTTCGGCATTACCTTTGTAACTCGAGTTACAAAGGTAATGCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015054.1-4971s1c1
Sequence:CCGGCCTCTTGTGTTCACACAGATTCTCGAGAATCTGTGTGAACACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-4450s1c1
Sequence:CCGGGCCTTCTCAGTCAGCTAACTTCTCGAGAAGTTAGCTGACTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-2783s1c1
Sequence:CCGGCCTGCTAGTCAGACATCCATTCTCGAGAATGGATGTCTGACTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-262s1c1
Sequence:CCGGGCACCTCTCCAGATTTACCAACTCGAGTTGGTAAATCTGGAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-4214s1c1
Sequence:CCGGCGGAGTAGTACAGTATCCCTTCTCGAGAAGGGATACTGTACTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015054.1-4782s1c1
Sequence:CCGGGAAAGTATTAGTACGGGCATTCTCGAGAATGCCCGTACTAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-1182s1c1
Sequence:CCGGCCTCCCATCATTTAGTGATTTCTCGAGAAATCACTAAATGATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-2636s1c1
Sequence:CCGGGCAGATATTCATCTCCTAGTTCTCGAGAACTAGGAGATGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015054
UHRF1BP1L MISSION shRNA Lentiviral Transduction Particles
UHRF1 binding protein 1-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015054.1-4654s1c1
Sequence:CCGGGCTCTGGAGTAGGAAGGTTATCTCGAGATAACCTTCCTACTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-2912s1c1
Sequence:CCGGCCTGATTATTTGCCTACAGAACTCGAGTTCTGTAGGCAAATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-4022s1c1
Sequence:CCGGGCTGTAATACACTCTTTACTTCTCGAGAAGTAAAGAGTGTATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-3916s1c1
Sequence:CCGGCCTTCGGCATTACCTTTGTAACTCGAGTTACAAAGGTAATGCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015054.1-4971s1c1
Sequence:CCGGCCTCTTGTGTTCACACAGATTCTCGAGAATCTGTGTGAACACAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-4450s1c1
Sequence:CCGGGCCTTCTCAGTCAGCTAACTTCTCGAGAAGTTAGCTGACTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-2783s1c1
Sequence:CCGGCCTGCTAGTCAGACATCCATTCTCGAGAATGGATGTCTGACTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-262s1c1
Sequence:CCGGGCACCTCTCCAGATTTACCAACTCGAGTTGGTAAATCTGGAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015054.1-4214s1c1
Sequence:CCGGCGGAGTAGTACAGTATCCCTTCTCGAGAAGGGATACTGTACTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015054.1-4782s1c1
Sequence:CCGGGAAAGTATTAGTACGGGCATTCTCGAGAATGCCCGTACTAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-1182s1c1
Sequence:CCGGCCTCCCATCATTTAGTGATTTCTCGAGAAATCACTAAATGATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015054.1-2636s1c1
Sequence:CCGGGCAGATATTCATCTCCTAGTTCTCGAGAACTAGGAGATGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks