EMAIL THIS PAGE TO A FRIEND

UHRF2

ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase

Synonyms: NIRF RNF107 URF2
UniProtKB ID: Q96PU4, Q5VYR1, Q5VYR3, Q659C8, Q8TAG7
Gene ID:
Human(115426) Summary: This gene encodes a nuclear protein which is involved in cell-cycle regulation. The encoded protein is a ubiquitin-ligase capable of ubiquinating PCNP (PEST-containing nuclear protein), and together they may play a role in tumorigenesis. The encoded protein contains an NIRF_N domain, a PHD finger, a set- and ring-associated (SRA) domain, and a RING finger domain and several of these domains have been shown to be essential for the regulation of cell proliferation. This protein may also have a role in intranuclear degradation of polyglutamine aggregates. Alternative splicing results in multiple transcript variants some of which are non-protein coding. [provided by RefSeq, Feb 2012]
Mouse(109113) ubiquitin-like, containing PHD and RING finger domains 2
Rat(309331) ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
chicken(431601) ubiquitin-like, containing PHD and RING finger domains, 2
dog(474702) ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
domestic cat(101093900) ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
cow(613759) ubiquitin-like with PHD and ring finger domains 2
sheep(101117220) ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
naked mole-rat(101725090) ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
domestic guinea pig(100715709) ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152306 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152896 Rosetta Predictions human pricing
NM_001107585 Rosetta Predictions rat pricing
NM_144873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075672 predicted 1653
2 SASI_Hs01_00075673 predicted 2253
3 SASI_Hs01_00075674 predicted 1947
4 SASI_Hs01_00075675 predicted 608
5 SASI_Hs01_00075676 predicted 1515
6 SASI_Hs01_00075677 predicted 589
7 SASI_Hs01_00075678 predicted 1499
8 SASI_Hs01_00075679 predicted 1769
9 SASI_Hs01_00075680 predicted 597
10 SASI_Hs02_00366862 predicted 2822
11 SASI_Hs01_00075681 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230285 predicted 2053
2 SASI_Rn02_00230286 predicted 642
3 SASI_Rn02_00230287 predicted 1104
4 SASI_Rn02_00230288 predicted 1401
5 SASI_Rn02_00230289 predicted 582
6 SASI_Rn02_00230290 predicted 580
7 SASI_Rn02_00230291 predicted 2644
8 SASI_Rn02_00230292 predicted 1633
9 SASI_Rn02_00230293 predicted 1147
10 SASI_Rn02_00230294 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115475 predicted 1880
2 SASI_Mm01_00115477 predicted 1634
3 SASI_Mm01_00115478 predicted 594
4 SASI_Mm01_00115479 predicted 2008
5 SASI_Mm02_00340317 predicted 779
6 SASI_Mm01_00115480 predicted 1585
7 SASI_Mm01_00115481 predicted 517
8 SASI_Mm01_00115483 predicted 1357
9 SASI_Mm02_00340318 predicted 2392
10 SASI_Mm02_00340319 predicted 2595
11 SASI_Mm01_00115476 predicted 1196
12 SASI_Mm01_00115482 predicted 1000
13 SASI_Mm01_00115484 predicted 1060
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152306
VALIDATED
UHRF2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-3321s1c1
Sequence:CCGGCGTCTCTTCTTCCATTACAATCTCGAGATTGTAATGGAAGAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152306.x-1532s1c1
Sequence:CCGGGAAGTTGTAAAGGCTGGTGAACTCGAGTTCACCAGCCTTTACAACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152306.x-1497s1c1
Sequence:CCGGACTGGTATTGTCCTTCTTGTACTCGAGTACAAGAAGGACAATACCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-945s1c1
Sequence:CCGGCTGCTGATGAAGACGTTATTTCTCGAGAAATAACGTCTTCATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-1070s1c1
Sequence:CCGGGTTGGTGATGTGGTAATGGTTCTCGAGAACCATTACCACATCACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152306
VALIDATED
UHRF2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-3321s1c1
Sequence:CCGGCGTCTCTTCTTCCATTACAATCTCGAGATTGTAATGGAAGAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152306.x-1532s1c1
Sequence:CCGGGAAGTTGTAAAGGCTGGTGAACTCGAGTTCACCAGCCTTTACAACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152306.x-1497s1c1
Sequence:CCGGACTGGTATTGTCCTTCTTGTACTCGAGTACAAGAAGGACAATACCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-945s1c1
Sequence:CCGGCTGCTGATGAAGACGTTATTTCTCGAGAAATAACGTCTTCATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-1070s1c1
Sequence:CCGGGTTGGTGATGTGGTAATGGTTCTCGAGAACCATTACCACATCACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152306
VALIDATED
UHRF2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-3321s1c1
Sequence:CCGGCGTCTCTTCTTCCATTACAATCTCGAGATTGTAATGGAAGAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152306.x-1532s1c1
Sequence:CCGGGAAGTTGTAAAGGCTGGTGAACTCGAGTTCACCAGCCTTTACAACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152306.x-1497s1c1
Sequence:CCGGACTGGTATTGTCCTTCTTGTACTCGAGTACAAGAAGGACAATACCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-945s1c1
Sequence:CCGGCTGCTGATGAAGACGTTATTTCTCGAGAAATAACGTCTTCATCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152306.x-1070s1c1
Sequence:CCGGGTTGGTGATGTGGTAATGGTTCTCGAGAACCATTACCACATCACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144873
VALIDATED
UHRF2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1921s1c1
Sequence:CCGGGCAACAGATATGATGGCATTTCTCGAGAAATGCCATCATATCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1760s1c1
Sequence:CCGGCCAGACACTAACAAACATGAACTCGAGTTCATGTTTGTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-786s1c1
Sequence:CCGGGCTGATGAAGACGTTATTTATCTCGAGATAAATAACGTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1324s1c1
Sequence:CCGGCGGAAGAGGAATACTGGTATTCTCGAGAATACCAGTATTCCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144873.1-2620s1c1
Sequence:CCGGCCTGGACAGTAACAAGTCTTACTCGAGTAAGACTTGTTACTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-2586s21c1
Sequence:CCGGCATGATCTCGGGCAGAATTATCTCGAGATAATTCTGCCCGAGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-543s21c1
Sequence:CCGGTCTTCTCATAATCCGCCTAAACTCGAGTTTAGGCGGATTATGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-1893s21c1
Sequence:CCGGGATGCTCCATTGGATGATAAACTCGAGTTTATCATCCAATGGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-1363s21c1
Sequence:CCGGGCAATATGGCCTATCACATTTCTCGAGAAATGTGATAGGCCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144873
VALIDATED
UHRF2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1921s1c1
Sequence:CCGGGCAACAGATATGATGGCATTTCTCGAGAAATGCCATCATATCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1760s1c1
Sequence:CCGGCCAGACACTAACAAACATGAACTCGAGTTCATGTTTGTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-786s1c1
Sequence:CCGGGCTGATGAAGACGTTATTTATCTCGAGATAAATAACGTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1324s1c1
Sequence:CCGGCGGAAGAGGAATACTGGTATTCTCGAGAATACCAGTATTCCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144873.1-2620s1c1
Sequence:CCGGCCTGGACAGTAACAAGTCTTACTCGAGTAAGACTTGTTACTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-2586s21c1
Sequence:CCGGCATGATCTCGGGCAGAATTATCTCGAGATAATTCTGCCCGAGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-543s21c1
Sequence:CCGGTCTTCTCATAATCCGCCTAAACTCGAGTTTAGGCGGATTATGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-1893s21c1
Sequence:CCGGGATGCTCCATTGGATGATAAACTCGAGTTTATCATCCAATGGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-1363s21c1
Sequence:CCGGGCAATATGGCCTATCACATTTCTCGAGAAATGTGATAGGCCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144873
VALIDATED
UHRF2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1921s1c1
Sequence:CCGGGCAACAGATATGATGGCATTTCTCGAGAAATGCCATCATATCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1760s1c1
Sequence:CCGGCCAGACACTAACAAACATGAACTCGAGTTCATGTTTGTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-786s1c1
Sequence:CCGGGCTGATGAAGACGTTATTTATCTCGAGATAAATAACGTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144873.1-1324s1c1
Sequence:CCGGCGGAAGAGGAATACTGGTATTCTCGAGAATACCAGTATTCCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144873.1-2620s1c1
Sequence:CCGGCCTGGACAGTAACAAGTCTTACTCGAGTAAGACTTGTTACTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-2586s21c1
Sequence:CCGGCATGATCTCGGGCAGAATTATCTCGAGATAATTCTGCCCGAGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-543s21c1
Sequence:CCGGTCTTCTCATAATCCGCCTAAACTCGAGTTTAGGCGGATTATGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-1893s21c1
Sequence:CCGGGATGCTCCATTGGATGATAAACTCGAGTTTATCATCCAATGGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144873.2-1363s21c1
Sequence:CCGGGCAATATGGCCTATCACATTTCTCGAGAAATGTGATAGGCCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152896
UHRF2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-525s21c1
Sequence:CCGGATGTTGGACTGAATGATATAACTCGAGTTATATCATTCAGTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-911s21c1
Sequence:CCGGAGTGTACCCTCTACGTCTAATCTCGAGATTAGACGTAGAGGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-946s21c1
Sequence:CCGGTGCTGATGAAGACGTTATTTACTCGAGTAAATAACGTCTTCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-1434s21c1
Sequence:CCGGGTAATGTGGCTTATCATATTTCTCGAGAAATATGATAAGCCACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-1644s21c1
Sequence:CCGGGTACGAGAGAATGTACTATTGCTCGAGCAATAGTACATTCTCTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152896
UHRF2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-525s21c1
Sequence:CCGGATGTTGGACTGAATGATATAACTCGAGTTATATCATTCAGTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-911s21c1
Sequence:CCGGAGTGTACCCTCTACGTCTAATCTCGAGATTAGACGTAGAGGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-946s21c1
Sequence:CCGGTGCTGATGAAGACGTTATTTACTCGAGTAAATAACGTCTTCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-1434s21c1
Sequence:CCGGGTAATGTGGCTTATCATATTTCTCGAGAAATATGATAAGCCACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-1644s21c1
Sequence:CCGGGTACGAGAGAATGTACTATTGCTCGAGCAATAGTACATTCTCTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152896
UHRF2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-525s21c1
Sequence:CCGGATGTTGGACTGAATGATATAACTCGAGTTATATCATTCAGTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-911s21c1
Sequence:CCGGAGTGTACCCTCTACGTCTAATCTCGAGATTAGACGTAGAGGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-946s21c1
Sequence:CCGGTGCTGATGAAGACGTTATTTACTCGAGTAAATAACGTCTTCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-1434s21c1
Sequence:CCGGGTAATGTGGCTTATCATATTTCTCGAGAAATATGATAAGCCACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152896.1-1644s21c1
Sequence:CCGGGTACGAGAGAATGTACTATTGCTCGAGCAATAGTACATTCTCTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks