EMAIL THIS PAGE TO A FRIEND

UIMC1

ubiquitin interaction motif containing 1

Synonyms: RAP80 X2HRIP110
Gene ID:
Mouse(20184) ubiquitin interaction motif containing 1
Rat(290997) ubiquitin interaction motif containing 1
chicken(416145) ubiquitin interaction motif containing 1
Horse(100058611) ubiquitin interaction motif containing 1
domestic cat(101101543) ubiquitin interaction motif containing 1
dog(611298) ubiquitin interaction motif containing 1
cow(508607) ubiquitin interaction motif containing 1
sheep(101119468) ubiquitin interaction motif containing 1
domestic guinea pig(100725402) ubiquitin interaction motif containing 1
naked mole-rat(101703646) ubiquitin interaction motif containing 1
Domestic Rabbit(100354766) ubiquitin interaction motif containing 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016290 Rosetta Predictions human pricing
NM_001013884 Rosetta Predictions rat pricing
NM_011307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219278 predicted 1505
2 SASI_Hs01_00219279 predicted 1459
3 SASI_Hs01_00219280 predicted 2259
4 SASI_Hs01_00219281 predicted 790
5 SASI_Hs01_00219282 predicted 1263
6 SASI_Hs02_00349213 predicted 1562
7 SASI_Hs01_00219284 predicted 915
8 SASI_Hs01_00219285 predicted 1726
9 SASI_Hs01_00219286 predicted 1847
10 SASI_Hs01_00219287 predicted 1244
11 SASI_Hs01_00219283 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084028 predicted 2151
2 SASI_Rn01_00084029 predicted 691
3 SASI_Rn01_00084030 predicted 1358
4 SASI_Rn01_00084031 predicted 258
5 SASI_Rn01_00084032 predicted 2183
6 SASI_Rn01_00084034 predicted 762
7 SASI_Rn01_00084035 predicted 1511
8 SASI_Rn01_00084036 predicted 1073
9 SASI_Rn01_00084037 predicted 1192
10 SASI_Rn02_00201160 predicted 2263
11 SASI_Rn01_00084033 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058880 predicted 954
2 SASI_Mm01_00058881 predicted 216
3 SASI_Mm01_00058882 predicted 1110
4 SASI_Mm02_00320387 predicted 877
5 SASI_Mm01_00058883 predicted 805
6 SASI_Mm01_00058884 predicted 458
7 SASI_Mm01_00058885 predicted 1686
8 SASI_Mm01_00058886 predicted 1718
9 SASI_Mm01_00058888 predicted 300
10 SASI_Mm01_00058889 predicted 1560
11 SASI_Mm01_00058887 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011307
VALIDATED
UIMC1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin interaction motif containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011307.2-961s21c1
Sequence:CCGGCTGGAGTAGATCCCAATCAATCTCGAGATTGATTGGGATCTACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-2241s21c1
Sequence:CCGGGCTTTCCGGTCACGAACTAAACTCGAGTTTAGTTCGTGACCGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-1563s21c1
Sequence:CCGGGGCGATAAGCAGGTTGCTAATCTCGAGATTAGCAACCTGCTTATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-732s21c1
Sequence:CCGGTTTGAGAATGAGAACGTTAAACTCGAGTTTAACGTTCTCATTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-2335s21c1
Sequence:CCGGTGATCGTGTTCATTAAGTATACTCGAGTATACTTAATGAACACGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-2410s1c1
Sequence:CCGGCCCATTCAGTATCCTGGCTTTCTCGAGAAAGCCAGGATACTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011307.1-1672s1c1
Sequence:CCGGCCCACAAAGATTGAACAGCATCTCGAGATGCTGTTCAATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-512s1c1
Sequence:CCGGCTGCTGAACTATCTTCACATTCTCGAGAATGTGAAGATAGTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-962s1c1
Sequence:CCGGCTGGAGTAGATCCCAATCAATCTCGAGATTGATTGGGATCTACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-1215s1c1
Sequence:CCGGGCACTCAGAAACCAAGGATTTCTCGAGAAATCCTTGGTTTCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011307
VALIDATED
UIMC1 MISSION shRNA shRNA Plasmid DNA
ubiquitin interaction motif containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011307.2-961s21c1
Sequence:CCGGCTGGAGTAGATCCCAATCAATCTCGAGATTGATTGGGATCTACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-2241s21c1
Sequence:CCGGGCTTTCCGGTCACGAACTAAACTCGAGTTTAGTTCGTGACCGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-1563s21c1
Sequence:CCGGGGCGATAAGCAGGTTGCTAATCTCGAGATTAGCAACCTGCTTATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-732s21c1
Sequence:CCGGTTTGAGAATGAGAACGTTAAACTCGAGTTTAACGTTCTCATTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-2335s21c1
Sequence:CCGGTGATCGTGTTCATTAAGTATACTCGAGTATACTTAATGAACACGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-2410s1c1
Sequence:CCGGCCCATTCAGTATCCTGGCTTTCTCGAGAAAGCCAGGATACTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011307.1-1672s1c1
Sequence:CCGGCCCACAAAGATTGAACAGCATCTCGAGATGCTGTTCAATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-512s1c1
Sequence:CCGGCTGCTGAACTATCTTCACATTCTCGAGAATGTGAAGATAGTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-962s1c1
Sequence:CCGGCTGGAGTAGATCCCAATCAATCTCGAGATTGATTGGGATCTACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-1215s1c1
Sequence:CCGGGCACTCAGAAACCAAGGATTTCTCGAGAAATCCTTGGTTTCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011307
VALIDATED
UIMC1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin interaction motif containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011307.2-961s21c1
Sequence:CCGGCTGGAGTAGATCCCAATCAATCTCGAGATTGATTGGGATCTACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-2241s21c1
Sequence:CCGGGCTTTCCGGTCACGAACTAAACTCGAGTTTAGTTCGTGACCGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-1563s21c1
Sequence:CCGGGGCGATAAGCAGGTTGCTAATCTCGAGATTAGCAACCTGCTTATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-732s21c1
Sequence:CCGGTTTGAGAATGAGAACGTTAAACTCGAGTTTAACGTTCTCATTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011307.2-2335s21c1
Sequence:CCGGTGATCGTGTTCATTAAGTATACTCGAGTATACTTAATGAACACGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-2410s1c1
Sequence:CCGGCCCATTCAGTATCCTGGCTTTCTCGAGAAAGCCAGGATACTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011307.1-1672s1c1
Sequence:CCGGCCCACAAAGATTGAACAGCATCTCGAGATGCTGTTCAATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-512s1c1
Sequence:CCGGCTGCTGAACTATCTTCACATTCTCGAGAATGTGAAGATAGTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-962s1c1
Sequence:CCGGCTGGAGTAGATCCCAATCAATCTCGAGATTGATTGGGATCTACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011307.1-1215s1c1
Sequence:CCGGGCACTCAGAAACCAAGGATTTCTCGAGAAATCCTTGGTTTCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016290
VALIDATED
UIMC1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin interaction motif containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-505s21c1
Sequence:CCGGCCATTGCTGAAAGCCTGAATACTCGAGTATTCAGGCTTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-793s21c1
Sequence:CCGGTTGAGAATGTGAACGTTAAATCTCGAGATTTAACGTTCACATTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-2391s21c1
Sequence:CCGGATAGTGGTCCCTAGTTCATTGCTCGAGCAATGAACTAGGGACCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-1631s21c1
Sequence:CCGGTGAGAAGGAAGTAGCTATTTCCTCGAGGAAATAGCTACTTCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-1056s21c1
Sequence:CCGGCTCTGCCAGTTGGAGGTTTATCTCGAGATAAACCTCCAACTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-1707s1c1
Sequence:CCGGCCCACAAAGATTGAACGACATCTCGAGATGTCGTTCAATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-1683s1c1
Sequence:CCGGCCGCTATGTGACCAATGCTTTCTCGAGAAAGCATTGGTCACATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-2186s1c1
Sequence:CCGGCTTAAATGAATCTCCCGTCAACTCGAGTTGACGGGAGATTCATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016290.3-667s1c1
Sequence:CCGGGCTCACATATCAGTCAGGGAACTCGAGTTCCCTGACTGATATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-505s1c1
Sequence:CCGGCCATTGCTGAAAGCCTGAATACTCGAGTATTCAGGCTTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016290
VALIDATED
UIMC1 MISSION shRNA shRNA Plasmid DNA
ubiquitin interaction motif containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-505s21c1
Sequence:CCGGCCATTGCTGAAAGCCTGAATACTCGAGTATTCAGGCTTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-793s21c1
Sequence:CCGGTTGAGAATGTGAACGTTAAATCTCGAGATTTAACGTTCACATTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-2391s21c1
Sequence:CCGGATAGTGGTCCCTAGTTCATTGCTCGAGCAATGAACTAGGGACCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-1631s21c1
Sequence:CCGGTGAGAAGGAAGTAGCTATTTCCTCGAGGAAATAGCTACTTCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-1056s21c1
Sequence:CCGGCTCTGCCAGTTGGAGGTTTATCTCGAGATAAACCTCCAACTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-1707s1c1
Sequence:CCGGCCCACAAAGATTGAACGACATCTCGAGATGTCGTTCAATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-1683s1c1
Sequence:CCGGCCGCTATGTGACCAATGCTTTCTCGAGAAAGCATTGGTCACATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-2186s1c1
Sequence:CCGGCTTAAATGAATCTCCCGTCAACTCGAGTTGACGGGAGATTCATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016290.3-667s1c1
Sequence:CCGGGCTCACATATCAGTCAGGGAACTCGAGTTCCCTGACTGATATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-505s1c1
Sequence:CCGGCCATTGCTGAAAGCCTGAATACTCGAGTATTCAGGCTTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016290
VALIDATED
UIMC1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin interaction motif containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-505s21c1
Sequence:CCGGCCATTGCTGAAAGCCTGAATACTCGAGTATTCAGGCTTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-793s21c1
Sequence:CCGGTTGAGAATGTGAACGTTAAATCTCGAGATTTAACGTTCACATTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-2391s21c1
Sequence:CCGGATAGTGGTCCCTAGTTCATTGCTCGAGCAATGAACTAGGGACCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-1631s21c1
Sequence:CCGGTGAGAAGGAAGTAGCTATTTCCTCGAGGAAATAGCTACTTCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016290.3-1056s21c1
Sequence:CCGGCTCTGCCAGTTGGAGGTTTATCTCGAGATAAACCTCCAACTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-1707s1c1
Sequence:CCGGCCCACAAAGATTGAACGACATCTCGAGATGTCGTTCAATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-1683s1c1
Sequence:CCGGCCGCTATGTGACCAATGCTTTCTCGAGAAAGCATTGGTCACATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-2186s1c1
Sequence:CCGGCTTAAATGAATCTCCCGTCAACTCGAGTTGACGGGAGATTCATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016290.3-667s1c1
Sequence:CCGGGCTCACATATCAGTCAGGGAACTCGAGTTCCCTGACTGATATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016290.3-505s1c1
Sequence:CCGGCCATTGCTGAAAGCCTGAATACTCGAGTATTCAGGCTTTCAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks