EMAIL THIS PAGE TO A FRIEND

ULBP1

UL16 binding protein 1

Synonyms: RAET1I
UniProtKB ID: Q9BZM6, Q5VY81, Q8IZW3, Q8IZX6
Gene ID:
Mouse(77777) UL16 binding protein 1
naked mole-rat(101718838) UL16 binding protein 1
cow(785237) UL16 binding protein 1
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025218 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025218 Rosetta Predictions human pricing
NM_029975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143200 predicted 571
2 SASI_Hs01_00143201 predicted 578
3 SASI_Hs01_00143202 predicted 606
4 SASI_Hs01_00143203 predicted 315
5 SASI_Hs01_00143204 predicted 756
6 SASI_Hs01_00143206 predicted 239
7 SASI_Hs01_00143207 predicted 531
8 SASI_Hs01_00143208 predicted 820
9 SASI_Hs01_00143209 predicted 515
10 SASI_Hs02_00358008 predicted 448
11 SASI_Hs01_00143205 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173613 predicted 753
2 SASI_Mm01_00173614 predicted 803
3 SASI_Mm02_00336306 predicted 406
4 SASI_Mm01_00173616 predicted 510
5 SASI_Mm01_00173618 predicted 368
6 SASI_Mm01_00173619 predicted 965
7 SASI_Mm01_00173620 predicted 277
8 SASI_Mm01_00173621 predicted 544
9 SASI_Mm01_00173622 predicted 924
10 SASI_Mm02_00336307 predicted 459
11 SASI_Mm01_00173615 predicted 1189
12 SASI_Mm01_00173617 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025218
ULBP1 MISSION shRNA Bacterial Glycerol Stock
UL16 binding protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-257s1c1
Sequence:CCGGCCTGGGAAGAACAAACTGAAACTCGAGTTTCAGTTTGTTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-84s1c1
Sequence:CCGGCGACACACACTGTCTTTGCTACTCGAGTAGCAAAGACAGTGTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-328s1c1
Sequence:CCGGGTGGAGAATTTAATACCCATTCTCGAGAATGGGTATTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-534s1c1
Sequence:CCGGGACCATGTTCTTCCAGAAGATCTCGAGATCTTCTGGAAGAACATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-423s1c1
Sequence:CCGGCCTCTTCAATGGACAGAAGTTCTCGAGAACTTCTGTCCATTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025218
ULBP1 MISSION shRNA shRNA Plasmid DNA
UL16 binding protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-257s1c1
Sequence:CCGGCCTGGGAAGAACAAACTGAAACTCGAGTTTCAGTTTGTTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-84s1c1
Sequence:CCGGCGACACACACTGTCTTTGCTACTCGAGTAGCAAAGACAGTGTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-328s1c1
Sequence:CCGGGTGGAGAATTTAATACCCATTCTCGAGAATGGGTATTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-534s1c1
Sequence:CCGGGACCATGTTCTTCCAGAAGATCTCGAGATCTTCTGGAAGAACATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-423s1c1
Sequence:CCGGCCTCTTCAATGGACAGAAGTTCTCGAGAACTTCTGTCCATTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025218
ULBP1 MISSION shRNA Lentiviral Transduction Particles
UL16 binding protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-257s1c1
Sequence:CCGGCCTGGGAAGAACAAACTGAAACTCGAGTTTCAGTTTGTTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-84s1c1
Sequence:CCGGCGACACACACTGTCTTTGCTACTCGAGTAGCAAAGACAGTGTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-328s1c1
Sequence:CCGGGTGGAGAATTTAATACCCATTCTCGAGAATGGGTATTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-534s1c1
Sequence:CCGGGACCATGTTCTTCCAGAAGATCTCGAGATCTTCTGGAAGAACATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025218.1-423s1c1
Sequence:CCGGCCTCTTCAATGGACAGAAGTTCTCGAGAACTTCTGTCCATTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029975
ULBP1 MISSION shRNA Bacterial Glycerol Stock
UL16 binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029975.1-1329s1c1
Sequence:CCGGCCTTTCTCATTCTTACATGATCTCGAGATCATGTAAGAATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-1079s1c1
Sequence:CCGGCCTGTGTTTATGCAGATTGATCTCGAGATCAATCTGCATAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-455s1c1
Sequence:CCGGGCTCATAGGAACAGCATGAATCTCGAGATTCATGCTGTTCCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-1014s1c1
Sequence:CCGGCTTCACCACAATCCAGTGTATCTCGAGATACACTGGATTGTGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-981s1c1
Sequence:CCGGCACCTCTCTTGGATGACTCTTCTCGAGAAGAGTCATCCAAGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029975
ULBP1 MISSION shRNA shRNA Plasmid DNA
UL16 binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029975.1-1329s1c1
Sequence:CCGGCCTTTCTCATTCTTACATGATCTCGAGATCATGTAAGAATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-1079s1c1
Sequence:CCGGCCTGTGTTTATGCAGATTGATCTCGAGATCAATCTGCATAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-455s1c1
Sequence:CCGGGCTCATAGGAACAGCATGAATCTCGAGATTCATGCTGTTCCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-1014s1c1
Sequence:CCGGCTTCACCACAATCCAGTGTATCTCGAGATACACTGGATTGTGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-981s1c1
Sequence:CCGGCACCTCTCTTGGATGACTCTTCTCGAGAAGAGTCATCCAAGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029975
ULBP1 MISSION shRNA Lentiviral Transduction Particles
UL16 binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029975.1-1329s1c1
Sequence:CCGGCCTTTCTCATTCTTACATGATCTCGAGATCATGTAAGAATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-1079s1c1
Sequence:CCGGCCTGTGTTTATGCAGATTGATCTCGAGATCAATCTGCATAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-455s1c1
Sequence:CCGGGCTCATAGGAACAGCATGAATCTCGAGATTCATGCTGTTCCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-1014s1c1
Sequence:CCGGCTTCACCACAATCCAGTGTATCTCGAGATACACTGGATTGTGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029975.1-981s1c1
Sequence:CCGGCACCTCTCTTGGATGACTCTTCTCGAGAAGAGTCATCCAAGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks