EMAIL THIS PAGE TO A FRIEND

ULBP2

UL16 binding protein 2

Synonyms: N2DL2 RAET1H
Species: Human ULBP2(80328)
UniProtKB ID: Q9BZM5, Q5VUN4
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP6348 ULBP2 human recombinant, expressed in E. coli, ≥85% (SDS-PAGE) human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1769 Human ULBP-2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025217 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107261 MISSION® esiRNA esiRNA human RAET1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025217 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206395 predicted 1006
2 SASI_Hs01_00206396 predicted 828
3 SASI_Hs01_00206397 predicted 1012
4 SASI_Hs01_00206399 predicted 938
5 SASI_Hs01_00206400 predicted 619
6 SASI_Hs01_00206401 predicted 1015
7 SASI_Hs01_00206402 predicted 807
8 SASI_Hs01_00206403 predicted 811
9 SASI_Hs02_00358006 predicted 1014
10 SASI_Hs02_00358007 predicted 1087
11 SASI_Hs01_00206394 predicted 518
12 SASI_Hs01_00206398 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025217
VALIDATED
ULBP2 MISSION shRNA Bacterial Glycerol Stock
UL16 binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-613s1c1
Sequence:CCGGGTCCTTCCATTACTTCTCAATCTCGAGATTGAGAAGTAATGGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-400s1c1
Sequence:CCGGGCTGGAGAATTACACACCCAACTCGAGTTGGGTGTGTAATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-496s1c1
Sequence:CCGGCAGTTTCGATGGGCAGATCTTCTCGAGAAGATCTGCCCATCGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025217.2-389s1c1
Sequence:CCGGCGTGACATTCAGCTGGAGAATCTCGAGATTCTCCAGCTGAATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025217.2-517s1c1
Sequence:CCGGCCTCCTCTTTGACTCAGAGAACTCGAGTTCTCTGAGTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025217.2-1085s21c1
Sequence:CCGGGGCTGACTAAACAAGATATATCTCGAGATATATCTTGTTTAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025217.2-822s21c1
Sequence:CCGGCCTTTAGAGTGACAGGTTAAACTCGAGTTTAACCTGTCACTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025217.2-864s21c1
Sequence:CCGGTGAGCACGGTCTTGATCAAACCTCGAGGTTTGATCAAGACCGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025217.2-959s21c1
Sequence:CCGGCATGGACCCAATAGCTCATTCCTCGAGGAATGAGCTATTGGGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025217.2-517s21c1
Sequence:CCGGCCTCCTCTTTGACTCAGAGAACTCGAGTTCTCTGAGTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025217
VALIDATED
ULBP2 MISSION shRNA shRNA Plasmid DNA
UL16 binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-613s1c1
Sequence:CCGGGTCCTTCCATTACTTCTCAATCTCGAGATTGAGAAGTAATGGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-400s1c1
Sequence:CCGGGCTGGAGAATTACACACCCAACTCGAGTTGGGTGTGTAATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-496s1c1
Sequence:CCGGCAGTTTCGATGGGCAGATCTTCTCGAGAAGATCTGCCCATCGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025217.2-389s1c1
Sequence:CCGGCGTGACATTCAGCTGGAGAATCTCGAGATTCTCCAGCTGAATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025217.2-517s1c1
Sequence:CCGGCCTCCTCTTTGACTCAGAGAACTCGAGTTCTCTGAGTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025217.2-1085s21c1
Sequence:CCGGGGCTGACTAAACAAGATATATCTCGAGATATATCTTGTTTAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025217.2-822s21c1
Sequence:CCGGCCTTTAGAGTGACAGGTTAAACTCGAGTTTAACCTGTCACTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025217.2-864s21c1
Sequence:CCGGTGAGCACGGTCTTGATCAAACCTCGAGGTTTGATCAAGACCGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025217.2-959s21c1
Sequence:CCGGCATGGACCCAATAGCTCATTCCTCGAGGAATGAGCTATTGGGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025217.2-517s21c1
Sequence:CCGGCCTCCTCTTTGACTCAGAGAACTCGAGTTCTCTGAGTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025217
VALIDATED
ULBP2 MISSION shRNA Lentiviral Transduction Particles
UL16 binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-613s1c1
Sequence:CCGGGTCCTTCCATTACTTCTCAATCTCGAGATTGAGAAGTAATGGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-400s1c1
Sequence:CCGGGCTGGAGAATTACACACCCAACTCGAGTTGGGTGTGTAATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025217.2-496s1c1
Sequence:CCGGCAGTTTCGATGGGCAGATCTTCTCGAGAAGATCTGCCCATCGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025217.2-389s1c1
Sequence:CCGGCGTGACATTCAGCTGGAGAATCTCGAGATTCTCCAGCTGAATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025217.2-517s1c1
Sequence:CCGGCCTCCTCTTTGACTCAGAGAACTCGAGTTCTCTGAGTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025217.2-1085s21c1
Sequence:CCGGGGCTGACTAAACAAGATATATCTCGAGATATATCTTGTTTAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025217.2-822s21c1
Sequence:CCGGCCTTTAGAGTGACAGGTTAAACTCGAGTTTAACCTGTCACTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025217.2-864s21c1
Sequence:CCGGTGAGCACGGTCTTGATCAAACCTCGAGGTTTGATCAAGACCGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025217.2-959s21c1
Sequence:CCGGCATGGACCCAATAGCTCATTCCTCGAGGAATGAGCTATTGGGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025217.2-517s21c1
Sequence:CCGGCCTCCTCTTTGACTCAGAGAACTCGAGTTCTCTGAGTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks