EMAIL THIS PAGE TO A FRIEND

ULBP3

UL16 binding protein 3

Synonyms: RAET1N
UniProtKB ID: Q9BZM4, Q5VY82, Q8IZX5, Q8TE75
Gene ID:
cow(508495) UL16 binding protein 3
sheep(101105258) UL16 binding protein 3
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1770 Human ULBP-3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024518 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021341 MISSION® esiRNA esiRNA human ULBP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024518 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071774 predicted 206
2 SASI_Hs01_00071775 predicted 194
3 SASI_Hs01_00071776 predicted 314
4 SASI_Hs01_00071777 predicted 212
5 SASI_Hs01_00071778 predicted 301
6 SASI_Hs01_00071779 predicted 230
7 SASI_Hs01_00071780 predicted 412
8 SASI_Hs01_00071781 predicted 366
9 SASI_Hs01_00071782 predicted 472
10 SASI_Hs02_00356797 predicted 333
11 SASI_Hs01_00071773 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024518
ULBP3 MISSION shRNA Bacterial Glycerol Stock
UL16 binding protein 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-90s1c1
Sequence:CCGGCGCTCACTCTCTCTGGTATAACTCGAGTTATACCAGAGAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-543s1c1
Sequence:CCGGCTTCTTCAAGATGGTCTCAATCTCGAGATTGAGACCATCTTGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-203s1c1
Sequence:CCGGGCAGTGACAAGGTCTTATCTACTCGAGTAGATAAGACCTTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-164s1c1
Sequence:CCGGGCCAGGTGGATCAGAAGAATTCTCGAGAATTCTTCTGATCCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-395s1c1
Sequence:CCGGCCGATGGATACATCCGTGGATCTCGAGATCCACGGATGTATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024518.1-41s21c1
Sequence:CCGGCGATTCTTCCGTACCTGCTATCTCGAGATAGCAGGTACGGAAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024518
ULBP3 MISSION shRNA shRNA Plasmid DNA
UL16 binding protein 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-90s1c1
Sequence:CCGGCGCTCACTCTCTCTGGTATAACTCGAGTTATACCAGAGAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-543s1c1
Sequence:CCGGCTTCTTCAAGATGGTCTCAATCTCGAGATTGAGACCATCTTGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-203s1c1
Sequence:CCGGGCAGTGACAAGGTCTTATCTACTCGAGTAGATAAGACCTTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-164s1c1
Sequence:CCGGGCCAGGTGGATCAGAAGAATTCTCGAGAATTCTTCTGATCCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-395s1c1
Sequence:CCGGCCGATGGATACATCCGTGGATCTCGAGATCCACGGATGTATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024518.1-41s21c1
Sequence:CCGGCGATTCTTCCGTACCTGCTATCTCGAGATAGCAGGTACGGAAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024518
ULBP3 MISSION shRNA Lentiviral Transduction Particles
UL16 binding protein 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-90s1c1
Sequence:CCGGCGCTCACTCTCTCTGGTATAACTCGAGTTATACCAGAGAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-543s1c1
Sequence:CCGGCTTCTTCAAGATGGTCTCAATCTCGAGATTGAGACCATCTTGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-203s1c1
Sequence:CCGGGCAGTGACAAGGTCTTATCTACTCGAGTAGATAAGACCTTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-164s1c1
Sequence:CCGGGCCAGGTGGATCAGAAGAATTCTCGAGAATTCTTCTGATCCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024518.1-395s1c1
Sequence:CCGGCCGATGGATACATCCGTGGATCTCGAGATCCACGGATGTATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024518.1-41s21c1
Sequence:CCGGCGATTCTTCCGTACCTGCTATCTCGAGATAGCAGGTACGGAAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks