EMAIL THIS PAGE TO A FRIEND

ULK1

unc-51 like autophagy activating kinase 1

Synonyms: ATG1 ATG1A UNC51 Unc51.1 hATG1
UniProtKB ID: O75385, Q9UQ28
Gene ID:
Mouse(22241) unc-51 like kinase 1
Rat(360827) unc-51 like autophagy activating kinase 1
chicken(416800) unc-51-like kinase 1 (C. elegans)
Horse(100062311) unc-51-like kinase 1 (C. elegans)
domestic cat(101098658) unc-51-like kinase 1 (C. elegans)
dog(477437) unc-51-like kinase 1 (C. elegans)
cow(526310) unc-51-like kinase 1 (C. elegans)
sheep(101117701) unc-51-like kinase 1 (C. elegans)
naked mole-rat(101714353) unc-51-like kinase 1 (C. elegans)
Domestic Rabbit(100350803) unc-51-like kinase 1 (C. elegans)
domestic guinea pig(100719170) unc-51-like kinase 1 (C. elegans)
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABC213 Anti-phospho ULK1 Antibody (Ser777) 100 µg, Anti-phospho ULK1 Antibody (Ser777) is a highly specific rabbit polyclonal antibody, that targets Autophagy-related protein & has been tested in western blotting & Peptide Inhibition Assay. pricing
ABC212 Anti-phospho ULK1 Antibody (Thr574) 100 µg, Detect Autophagy-related protein;ATG1 using this rabbit polyclonal antibody, Anti-phospho ULK1 Antibody (Thr574) validated for use in western blotting & Peptide Inhibition Assay. pricing
ABC112 Anti-phospho-ULK1/ATG1 (Ser758) Antibody 100 µL, Detect phospho-ULK1/ATG1 (Ser758) using this Anti-phospho-ULK1/ATG1 (Ser758) Antibody validated for use in Western Blotting, Peptide Inhibition Assay. pricing
MABC307 Anti-phospho-ULK1 (Ser 467), clone 15D12.3 Antibody 100 µg, This Anti-phospho-ULK1 (Ser 467) antibody, clone 15D12.3 is validated for use in western blotting for the detection of phospho-ULK1 (Ser 467). pricing
ABC124 Anti-phospho-ULK1 (Ser555) Antibody 100 µg, This Anti-phospho-ULK1 (Ser555) Antibody is validated for use in Western Blotting, Peptide Inhibition Assay for the detection of phospho-ULK1 (Ser555). pricing
MABC736 Anti-phospho-ULK1 (Ser556), clone EPR6156, Rabbit Monoclonal Antibody 100 µL, Anti-phospho-ULK1 (Ser556), clone EPR6156, Rabbit Monoclonal is an antibody against phospho-ULK1 (Ser556) for use in Western Blotting. pricing
MABC734 Anti-phospho-ULK1 (Ser623), clone EPR6154, Rabbit Monoclonal Antibody 100 µL, Anti-phospho-ULK1 (Ser623), clone EPR6154, Rabbit Monoclonal is an antibody against phospho-ULK1 (Ser623) for use in Western Blotting. pricing
MABC306 Anti-phospho-ULK1 (Ser638) Antibody, clone 6B3.2 100 µg, This Anti-phospho-ULK1 (Ser638) Antibody, clone 6B3.2 is validated for use in Western Blotting and Immunocytochemistry for the detection of phospho-ULK1 (Ser638). pricing
MABC735 Anti-phospho-ULK1 (Ser638), clone EPR6155, Rabbit Monoclonal Antibody 100 µL, Anti-phospho-ULK1 (Ser638), clone EPR6155, Rabbit Monoclonal is an antibody against phospho-ULK1 (Ser638) for use in Western Blotting. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003565 Rosetta Predictions human pricing
NM_001108341 Rosetta Predictions rat pricing
NM_009469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335869 predicted 2955
2 SASI_Hs01_00016826 predicted 3893
3 SASI_Hs01_00016827 predicted 3492
4 SASI_Hs01_00016828 predicted 3743
5 SASI_Hs01_00016830 predicted 2150
6 SASI_Hs01_00016832 predicted 1769
7 SASI_Hs01_00016833 predicted 2781
8 SASI_Hs01_00016834 predicted 3357
9 SASI_Hs01_00016835 predicted 566
10 SASI_Hs02_00335870 predicted 1774
11 SASI_Hs01_00016829 predicted 3077
12 SASI_Hs01_00016831 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237709 predicted 2657
2 SASI_Rn02_00237710 predicted 1124
3 SASI_Rn02_00237711 predicted 290
4 SASI_Rn02_00237712 predicted 3131
5 SASI_Rn02_00237713 predicted 2845
6 SASI_Rn02_00237714 predicted 1073
7 SASI_Rn02_00237715 predicted 334
8 SASI_Rn02_00237716 predicted 1842
9 SASI_Rn02_00237717 predicted 1888
10 SASI_Rn02_00237718 predicted 1985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035374 predicted 3122
2 SASI_Mm01_00035375 predicted 608
3 SASI_Mm01_00035376 predicted 3432
4 SASI_Mm01_00035377 predicted 3444
5 SASI_Mm01_00035379 predicted 664
6 SASI_Mm01_00035380 predicted 652
7 SASI_Mm01_00035381 predicted 2160
8 SASI_Mm01_00035382 predicted 3226
9 SASI_Mm02_00316193 predicted 3163
10 SASI_Mm02_00316194 predicted 1118
11 SASI_Mm01_00035373 predicted 2652
12 SASI_Mm01_00035378 predicted 1396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003565
VALIDATED
ULK1 MISSION shRNA Bacterial Glycerol Stock
unc-51 like autophagy activating kinase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-5154s1c1
Sequence:CCGGGCCCTTTGCGTTATATTGTATCTCGAGATACAATATAACGCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.x-403s1c1
Sequence:CCGGCAAGTGCATTAACAAGAAGAACTCGAGTTCTTCTTGTTAATGCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-3345s1c1
Sequence:CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-1772s1c1
Sequence:CCGGTACACGCCATCTCCTCAAGTTCTCGAGAACTTGAGGAGATGGCGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-535s1c1
Sequence:CCGGCCTGGTTATGGAGTACTGCAACTCGAGTTGCAGTACTCCATAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.1-955s1c1
Sequence:CCGGGCGCCTGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.1-3079s1c1
Sequence:CCGGCAGGCTGAATGAGCTGTACAACTCGAGTTGTACAGCTCATTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-1064s1c1
Sequence:CCGGCGCATGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-4165s1c1
Sequence:CCGGGCCCTGGATACGTCTTGTAATCTCGAGATTACAAGACGTATCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-298s1c1
Sequence:CCGGCGTGGGCAAGTTCGAGTTCTCCTCGAGGAGAACTCGAACTTGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-955s21c1
Sequence:CCGGGCGCCTGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-1064s21c1
Sequence:CCGGCGCATGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-3345s21c1
Sequence:CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-1772s21c1
Sequence:CCGGTACACGCCATCTCCTCAAGTTCTCGAGAACTTGAGGAGATGGCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003565
VALIDATED
ULK1 MISSION shRNA shRNA Plasmid DNA
unc-51 like autophagy activating kinase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-5154s1c1
Sequence:CCGGGCCCTTTGCGTTATATTGTATCTCGAGATACAATATAACGCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.x-403s1c1
Sequence:CCGGCAAGTGCATTAACAAGAAGAACTCGAGTTCTTCTTGTTAATGCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-3345s1c1
Sequence:CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-1772s1c1
Sequence:CCGGTACACGCCATCTCCTCAAGTTCTCGAGAACTTGAGGAGATGGCGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-535s1c1
Sequence:CCGGCCTGGTTATGGAGTACTGCAACTCGAGTTGCAGTACTCCATAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.1-955s1c1
Sequence:CCGGGCGCCTGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.1-3079s1c1
Sequence:CCGGCAGGCTGAATGAGCTGTACAACTCGAGTTGTACAGCTCATTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-1064s1c1
Sequence:CCGGCGCATGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-4165s1c1
Sequence:CCGGGCCCTGGATACGTCTTGTAATCTCGAGATTACAAGACGTATCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-298s1c1
Sequence:CCGGCGTGGGCAAGTTCGAGTTCTCCTCGAGGAGAACTCGAACTTGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-955s21c1
Sequence:CCGGGCGCCTGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-1064s21c1
Sequence:CCGGCGCATGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-3345s21c1
Sequence:CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-1772s21c1
Sequence:CCGGTACACGCCATCTCCTCAAGTTCTCGAGAACTTGAGGAGATGGCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003565
VALIDATED
ULK1 MISSION shRNA Lentiviral Transduction Particles
unc-51 like autophagy activating kinase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-5154s1c1
Sequence:CCGGGCCCTTTGCGTTATATTGTATCTCGAGATACAATATAACGCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.x-403s1c1
Sequence:CCGGCAAGTGCATTAACAAGAAGAACTCGAGTTCTTCTTGTTAATGCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-3345s1c1
Sequence:CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-1772s1c1
Sequence:CCGGTACACGCCATCTCCTCAAGTTCTCGAGAACTTGAGGAGATGGCGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.x-535s1c1
Sequence:CCGGCCTGGTTATGGAGTACTGCAACTCGAGTTGCAGTACTCCATAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.1-955s1c1
Sequence:CCGGGCGCCTGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003565.1-3079s1c1
Sequence:CCGGCAGGCTGAATGAGCTGTACAACTCGAGTTGTACAGCTCATTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-1064s1c1
Sequence:CCGGCGCATGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-4165s1c1
Sequence:CCGGGCCCTGGATACGTCTTGTAATCTCGAGATTACAAGACGTATCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003565.1-298s1c1
Sequence:CCGGCGTGGGCAAGTTCGAGTTCTCCTCGAGGAGAACTCGAACTTGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-955s21c1
Sequence:CCGGGCGCCTGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-1064s21c1
Sequence:CCGGCGCATGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-3345s21c1
Sequence:CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003565.2-1772s21c1
Sequence:CCGGTACACGCCATCTCCTCAAGTTCTCGAGAACTTGAGGAGATGGCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009469
VALIDATED
ULK1 MISSION shRNA Bacterial Glycerol Stock
unc-51 like autophagy activating kinase 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-1153s1c1
Sequence:CCGGCGCATGGACTTTGATGAATTTCTCGAGAAATTCATCAAAGTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-3451s1c1
Sequence:CCGGGCCAAATGCAAGCTGTGCATTCTCGAGAATGCACAGCTTGCATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-624s1c1
Sequence:CCGGCCTGGTCATGGAGTATTGTAACTCGAGTTACAATACTCCATGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-3235s1c1
Sequence:CCGGCGCTTCTTTCTGGACAAACAACTCGAGTTGTTTGTCCAGAAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-834s1c1
Sequence:CCGGCCGAGTCAAGATTGCTGACTTCTCGAGAAGTCAGCAATCTTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-597s21c1
Sequence:CCGGCTTCCAGGAAATGGCTAATTCCTCGAGGAATTAGCCATTTCCTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-3451s21c1
Sequence:CCGGGCCAAATGCAAGCTGTGCATTCTCGAGAATGCACAGCTTGCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-3235s21c1
Sequence:CCGGCGCTTCTTTCTGGACAAACAACTCGAGTTGTTTGTCCAGAAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-1153s21c1
Sequence:CCGGCGCATGGACTTTGATGAATTTCTCGAGAAATTCATCAAAGTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009469.3-3957s21c1
Sequence:CCGGTCTCCCTCTGAGACTACTTACCTCGAGGTAAGTAGTCTCAGAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-834s21c1
Sequence:CCGGCCGAGTCAAGATTGCTGACTTCTCGAGAAGTCAGCAATCTTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-3160s21c1
Sequence:CCGGCAGGTGGTACGCAGACTAAATCTCGAGATTTAGTCTGCGTACCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009469
VALIDATED
ULK1 MISSION shRNA shRNA Plasmid DNA
unc-51 like autophagy activating kinase 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-1153s1c1
Sequence:CCGGCGCATGGACTTTGATGAATTTCTCGAGAAATTCATCAAAGTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-3451s1c1
Sequence:CCGGGCCAAATGCAAGCTGTGCATTCTCGAGAATGCACAGCTTGCATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-624s1c1
Sequence:CCGGCCTGGTCATGGAGTATTGTAACTCGAGTTACAATACTCCATGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-3235s1c1
Sequence:CCGGCGCTTCTTTCTGGACAAACAACTCGAGTTGTTTGTCCAGAAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-834s1c1
Sequence:CCGGCCGAGTCAAGATTGCTGACTTCTCGAGAAGTCAGCAATCTTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-597s21c1
Sequence:CCGGCTTCCAGGAAATGGCTAATTCCTCGAGGAATTAGCCATTTCCTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-3451s21c1
Sequence:CCGGGCCAAATGCAAGCTGTGCATTCTCGAGAATGCACAGCTTGCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-3235s21c1
Sequence:CCGGCGCTTCTTTCTGGACAAACAACTCGAGTTGTTTGTCCAGAAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-1153s21c1
Sequence:CCGGCGCATGGACTTTGATGAATTTCTCGAGAAATTCATCAAAGTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009469.3-3957s21c1
Sequence:CCGGTCTCCCTCTGAGACTACTTACCTCGAGGTAAGTAGTCTCAGAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-834s21c1
Sequence:CCGGCCGAGTCAAGATTGCTGACTTCTCGAGAAGTCAGCAATCTTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-3160s21c1
Sequence:CCGGCAGGTGGTACGCAGACTAAATCTCGAGATTTAGTCTGCGTACCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009469
VALIDATED
ULK1 MISSION shRNA Lentiviral Transduction Particles
unc-51 like autophagy activating kinase 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-1153s1c1
Sequence:CCGGCGCATGGACTTTGATGAATTTCTCGAGAAATTCATCAAAGTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-3451s1c1
Sequence:CCGGGCCAAATGCAAGCTGTGCATTCTCGAGAATGCACAGCTTGCATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-624s1c1
Sequence:CCGGCCTGGTCATGGAGTATTGTAACTCGAGTTACAATACTCCATGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-3235s1c1
Sequence:CCGGCGCTTCTTTCTGGACAAACAACTCGAGTTGTTTGTCCAGAAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009469.3-834s1c1
Sequence:CCGGCCGAGTCAAGATTGCTGACTTCTCGAGAAGTCAGCAATCTTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-597s21c1
Sequence:CCGGCTTCCAGGAAATGGCTAATTCCTCGAGGAATTAGCCATTTCCTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-3451s21c1
Sequence:CCGGGCCAAATGCAAGCTGTGCATTCTCGAGAATGCACAGCTTGCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-3235s21c1
Sequence:CCGGCGCTTCTTTCTGGACAAACAACTCGAGTTGTTTGTCCAGAAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-1153s21c1
Sequence:CCGGCGCATGGACTTTGATGAATTTCTCGAGAAATTCATCAAAGTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009469.3-3957s21c1
Sequence:CCGGTCTCCCTCTGAGACTACTTACCTCGAGGTAAGTAGTCTCAGAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009469.3-834s21c1
Sequence:CCGGCCGAGTCAAGATTGCTGACTTCTCGAGAAGTCAGCAATCTTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009469.3-3160s21c1
Sequence:CCGGCAGGTGGTACGCAGACTAAATCTCGAGATTTAGTCTGCGTACCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks