EMAIL THIS PAGE TO A FRIEND

ULK2

unc-51 like autophagy activating kinase 2

Synonyms: ATG1B Unc51.2
UniProtKB ID: Q8IYT8, A8MY69, O75119
Gene ID:
Human(9706) Summary: This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
Mouse(29869) unc-51 like kinase 2
Rat(303206) unc-51 like autophagy activating kinase 2
Zebrafish(100329702) unc-51-like kinase 2 (C. elegans)
chicken(417614) unc-51-like kinase 2 (C. elegans)
dog(489525) unc-51-like kinase 2 (C. elegans)
domestic cat(101083981) unc-51-like kinase 2 (C. elegans)
Horse(100073154) unc-51-like kinase 2 (C. elegans)
domestic guinea pig(100720864) unc-51-like kinase 2 (C. elegans)
Domestic Rabbit(100353118) unc-51-like kinase 2 (C. elegans)
cow(618601) unc-51-like kinase 2 (C. elegans)
sheep(101108239) unc-51-like kinase 2 (C. elegans)
221 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411987 ANTI-ULK2 antibody produced in mouse clone 2A12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411988 ANTI-ULK2 antibody produced in mouse clone 7G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411989 ANTI-ULK2 antibody produced in mouse clone 8G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411990 ANTI-ULK2 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412135 ANTI-ULK2 antibody produced in mouse clone 5E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412558 ANTI-ULK2 antibody produced in mouse clone 1A1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412559 ANTI-ULK2 antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA009027 Anti-ULK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
U8008 Anti-ULK2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
WH0009706M1 Monoclonal Anti-ULK2 antibody produced in mouse clone 6C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404750 Monoclonal Anti-ULK2 antibody produced in mouse clone 6D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074101 MISSION® esiRNA esiRNA human ULK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014683 Rosetta Predictions human pricing
XM_001077885 Rosetta Predictions rat pricing
XM_220541 Rosetta Predictions rat pricing
NM_013881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157141 predicted 2346
2 SASI_Hs01_00157142 predicted 1182
3 SASI_Hs01_00157143 predicted 1145
4 SASI_Hs01_00157144 predicted 705
5 SASI_Hs02_00346047 predicted 2483
6 SASI_Hs01_00157145 predicted 2496
7 SASI_Hs01_00157146 predicted 3332
8 SASI_Hs01_00157147 predicted 2711
9 SASI_Hs01_00157148 predicted 3219
10 SASI_Hs01_00157149 predicted 1566
11 SASI_Hs01_00157150 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358881 predicted 1086
2 SASI_Rn02_00358882 predicted 1286
3 SASI_Rn02_00358883 predicted 1195
4 SASI_Rn02_00358884 predicted 1511
5 SASI_Rn02_00358885 predicted 1755
6 SASI_Rn02_00358886 predicted 1772
7 SASI_Rn02_00358887 predicted 1708
8 SASI_Rn02_00358888 predicted 787
9 SASI_Rn02_00358889 predicted 915
10 SASI_Rn02_00358890 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379381 predicted 1083
2 SASI_Rn02_00379382 predicted 1282
3 SASI_Rn02_00379383 predicted 1197
4 SASI_Rn02_00379384 predicted 1512
5 SASI_Rn02_00379385 predicted 1733
6 SASI_Rn02_00379386 predicted 1744
7 SASI_Rn02_00379387 predicted 787
8 SASI_Rn02_00379388 predicted 909
9 SASI_Rn02_00379389 predicted 1440
10 SASI_Rn02_00379390 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115645 predicted 1043
2 SASI_Mm01_00115646 predicted 2882
3 SASI_Mm01_00115647 predicted 608
4 SASI_Mm01_00115648 predicted 724
5 SASI_Mm01_00115649 predicted 759
6 SASI_Mm01_00115650 predicted 1257
7 SASI_Mm01_00115651 predicted 1941
8 SASI_Mm01_00115653 predicted 525
9 SASI_Mm01_00115654 predicted 314
10 SASI_Mm02_00322907 predicted 2044
11 SASI_Mm01_00115652 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014683
VALIDATED
ULK2 MISSION shRNA Bacterial Glycerol Stock
unc-51 like autophagy activating kinase 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-3458s21c1
Sequence:CCGGGCAGACCGAAGATATTGTTTACTCGAGTAAACAATATCTTCGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-3390s21c1
Sequence:CCGGGCAGAGAAACTCATCTATAATCTCGAGATTATAGATGAGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-606s21c1
Sequence:CCGGGATTGGGAGGTAGCTATTAAACTCGAGTTTAATAGCTACCTCCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-780s1c1
Sequence:CCGGGCAGATTATTTGCAAGCGAAACTCGAGTTTCGCTTGCAAATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-4481s1c1
Sequence:CCGGCCTGTGACCTTAGGTTTATTACTCGAGTAATAAACCTAAGGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-1147s1c1
Sequence:CCGGCCAATAGTCCTCAAGACTTAACTCGAGTTAAGTCTTGAGGACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014683.2-2252s1c1
Sequence:CCGGGAGTTCTGACTGGTTCTTTAACTCGAGTTAAAGAACCAGTCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-597s1c1
Sequence:CCGGGATTGGGAGGTAGCTATTAAACTCGAGTTTAATAGCTACCTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-3381s1c1
Sequence:CCGGGCAGAGAAACTCATCTATAATCTCGAGATTATAGATGAGTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014683.x-4036s1c1
Sequence:CCGGGCAGTTTGATATTTGGAGTAACTCGAGTTACTCCAAATATCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-945s1c1
Sequence:CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-1208s1c1
Sequence:CCGGTCCCAGAGAAACATCACCTTACTCGAGTAAGGTGATGTTTCTCTGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-3449s1c1
Sequence:CCGGGCAGACCGAAGATATTGTTTACTCGAGTAAACAATATCTTCGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014683.x-3390s1c1
Sequence:CCGGCTCATCTATAATTGTGCTGTACTCGAGTACAGCACAATTATAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014683
VALIDATED
ULK2 MISSION shRNA shRNA Plasmid DNA
unc-51 like autophagy activating kinase 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-3458s21c1
Sequence:CCGGGCAGACCGAAGATATTGTTTACTCGAGTAAACAATATCTTCGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-3390s21c1
Sequence:CCGGGCAGAGAAACTCATCTATAATCTCGAGATTATAGATGAGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-606s21c1
Sequence:CCGGGATTGGGAGGTAGCTATTAAACTCGAGTTTAATAGCTACCTCCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-780s1c1
Sequence:CCGGGCAGATTATTTGCAAGCGAAACTCGAGTTTCGCTTGCAAATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-4481s1c1
Sequence:CCGGCCTGTGACCTTAGGTTTATTACTCGAGTAATAAACCTAAGGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-1147s1c1
Sequence:CCGGCCAATAGTCCTCAAGACTTAACTCGAGTTAAGTCTTGAGGACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014683.2-2252s1c1
Sequence:CCGGGAGTTCTGACTGGTTCTTTAACTCGAGTTAAAGAACCAGTCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-597s1c1
Sequence:CCGGGATTGGGAGGTAGCTATTAAACTCGAGTTTAATAGCTACCTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-3381s1c1
Sequence:CCGGGCAGAGAAACTCATCTATAATCTCGAGATTATAGATGAGTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014683.x-4036s1c1
Sequence:CCGGGCAGTTTGATATTTGGAGTAACTCGAGTTACTCCAAATATCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-945s1c1
Sequence:CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-1208s1c1
Sequence:CCGGTCCCAGAGAAACATCACCTTACTCGAGTAAGGTGATGTTTCTCTGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-3449s1c1
Sequence:CCGGGCAGACCGAAGATATTGTTTACTCGAGTAAACAATATCTTCGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014683.x-3390s1c1
Sequence:CCGGCTCATCTATAATTGTGCTGTACTCGAGTACAGCACAATTATAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014683
VALIDATED
ULK2 MISSION shRNA Lentiviral Transduction Particles
unc-51 like autophagy activating kinase 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-3458s21c1
Sequence:CCGGGCAGACCGAAGATATTGTTTACTCGAGTAAACAATATCTTCGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-3390s21c1
Sequence:CCGGGCAGAGAAACTCATCTATAATCTCGAGATTATAGATGAGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014683.3-606s21c1
Sequence:CCGGGATTGGGAGGTAGCTATTAAACTCGAGTTTAATAGCTACCTCCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-780s1c1
Sequence:CCGGGCAGATTATTTGCAAGCGAAACTCGAGTTTCGCTTGCAAATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-4481s1c1
Sequence:CCGGCCTGTGACCTTAGGTTTATTACTCGAGTAATAAACCTAAGGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-1147s1c1
Sequence:CCGGCCAATAGTCCTCAAGACTTAACTCGAGTTAAGTCTTGAGGACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014683.2-2252s1c1
Sequence:CCGGGAGTTCTGACTGGTTCTTTAACTCGAGTTAAAGAACCAGTCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-597s1c1
Sequence:CCGGGATTGGGAGGTAGCTATTAAACTCGAGTTTAATAGCTACCTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.2-3381s1c1
Sequence:CCGGGCAGAGAAACTCATCTATAATCTCGAGATTATAGATGAGTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014683.x-4036s1c1
Sequence:CCGGGCAGTTTGATATTTGGAGTAACTCGAGTTACTCCAAATATCAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-945s1c1
Sequence:CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-1208s1c1
Sequence:CCGGTCCCAGAGAAACATCACCTTACTCGAGTAAGGTGATGTTTCTCTGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014683.x-3449s1c1
Sequence:CCGGGCAGACCGAAGATATTGTTTACTCGAGTAAACAATATCTTCGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014683.x-3390s1c1
Sequence:CCGGCTCATCTATAATTGTGCTGTACTCGAGTACAGCACAATTATAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013881
VALIDATED
ULK2 MISSION shRNA Bacterial Glycerol Stock
unc-51 like autophagy activating kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-2993s21c1
Sequence:CCGGGCAGACTGAAGACATCGTTTACTCGAGTAAACGATGTCTTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-1275s21c1
Sequence:CCGGCGCATAGAACAGAATCTTATACTCGAGTATAAGATTCTGTTCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-2526s21c1
Sequence:CCGGCGCCATCTGAACATGATGTTACTCGAGTAACATCATGTTCAGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-588s21c1
Sequence:CCGGCCCGAGGTTATTATGTCTCAACTCGAGTTGAGACATAATAACCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-1045s21c1
Sequence:CCGGCCAAAGACTCTGCGAGTAATACTCGAGTATTACTCGCAGAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-2993s1c1
Sequence:CCGGGCAGACTGAAGACATCGTTTACTCGAGTAAACGATGTCTTCAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-1275s1c1
Sequence:CCGGCGCATAGAACAGAATCTTATACTCGAGTATAAGATTCTGTTCTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-2526s1c1
Sequence:CCGGCGCCATCTGAACATGATGTTACTCGAGTAACATCATGTTCAGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-1045s1c1
Sequence:CCGGCCAAAGACTCTGCGAGTAATACTCGAGTATTACTCGCAGAGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-588s1c1
Sequence:CCGGCCCGAGGTTATTATGTCTCAACTCGAGTTGAGACATAATAACCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013881
VALIDATED
ULK2 MISSION shRNA shRNA Plasmid DNA
unc-51 like autophagy activating kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-2993s21c1
Sequence:CCGGGCAGACTGAAGACATCGTTTACTCGAGTAAACGATGTCTTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-1275s21c1
Sequence:CCGGCGCATAGAACAGAATCTTATACTCGAGTATAAGATTCTGTTCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-2526s21c1
Sequence:CCGGCGCCATCTGAACATGATGTTACTCGAGTAACATCATGTTCAGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-588s21c1
Sequence:CCGGCCCGAGGTTATTATGTCTCAACTCGAGTTGAGACATAATAACCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-1045s21c1
Sequence:CCGGCCAAAGACTCTGCGAGTAATACTCGAGTATTACTCGCAGAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-2993s1c1
Sequence:CCGGGCAGACTGAAGACATCGTTTACTCGAGTAAACGATGTCTTCAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-1275s1c1
Sequence:CCGGCGCATAGAACAGAATCTTATACTCGAGTATAAGATTCTGTTCTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-2526s1c1
Sequence:CCGGCGCCATCTGAACATGATGTTACTCGAGTAACATCATGTTCAGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-1045s1c1
Sequence:CCGGCCAAAGACTCTGCGAGTAATACTCGAGTATTACTCGCAGAGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-588s1c1
Sequence:CCGGCCCGAGGTTATTATGTCTCAACTCGAGTTGAGACATAATAACCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013881
VALIDATED
ULK2 MISSION shRNA Lentiviral Transduction Particles
unc-51 like autophagy activating kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-2993s21c1
Sequence:CCGGGCAGACTGAAGACATCGTTTACTCGAGTAAACGATGTCTTCAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-1275s21c1
Sequence:CCGGCGCATAGAACAGAATCTTATACTCGAGTATAAGATTCTGTTCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-2526s21c1
Sequence:CCGGCGCCATCTGAACATGATGTTACTCGAGTAACATCATGTTCAGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-588s21c1
Sequence:CCGGCCCGAGGTTATTATGTCTCAACTCGAGTTGAGACATAATAACCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013881.3-1045s21c1
Sequence:CCGGCCAAAGACTCTGCGAGTAATACTCGAGTATTACTCGCAGAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-2993s1c1
Sequence:CCGGGCAGACTGAAGACATCGTTTACTCGAGTAAACGATGTCTTCAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-1275s1c1
Sequence:CCGGCGCATAGAACAGAATCTTATACTCGAGTATAAGATTCTGTTCTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-2526s1c1
Sequence:CCGGCGCCATCTGAACATGATGTTACTCGAGTAACATCATGTTCAGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-1045s1c1
Sequence:CCGGCCAAAGACTCTGCGAGTAATACTCGAGTATTACTCGCAGAGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013881.3-588s1c1
Sequence:CCGGCCCGAGGTTATTATGTCTCAACTCGAGTTGAGACATAATAACCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks