EMAIL THIS PAGE TO A FRIEND

ULK3

unc-51 like kinase 3

UniProtKB ID: Q6PHR2, B2RXK3, B4DRQ7, D3DW68, Q9NPN5, Q9UFS4
Gene ID:
Mouse(71742) unc-51-like kinase 3
Rat(691171) unc-51 like kinase 3
cow(506063) unc-51-like kinase 3 (C. elegans)
sheep(101119510) unc-51-like kinase 3 (C. elegans)
naked mole-rat(101711424) unc-51-like kinase 3 (C. elegans)
domestic guinea pig(100724626) unc-51-like kinase 3 (C. elegans)
Zebrafish(100037316) unc-51-like kinase 3 (C. elegans)
domestic cat(101082826) unc-51-like kinase 3 (C. elegans)
Horse(100062139) unc-51-like kinase 3 (C. elegans)
dog(487651) unc-51-like kinase 3 (C. elegans)
chicken(769780) unc-51-like kinase 3 (C. elegans)
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302344 ANTI-MOUSE ULK3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501698 Anti-ULK3 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human, canine
ELISA pricing
SAB1300975 Anti-ULK3 (center) antibody produced in rabbit Ig fraction of antiserum, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB1300974 Anti-ULK3 (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1407272 Anti-ULK3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1409085 Anti-ULK3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200132 Anti-ULK3 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody human
western blot pricing
HPA040474 Anti-ULK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4501102 Anti-ULK3 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
SAB3501067 Anti-ULK3 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015518 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001127720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001127720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001127720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040221 MISSION® esiRNA esiRNA human ULK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099436 Rosetta Predictions human pricing
XM_001077085 Rosetta Predictions rat pricing
XM_620754 Rosetta Predictions mouse pricing
XM_925013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320729 predicted 1708
2 SASI_Hs02_00320730 predicted 223
3 SASI_Hs02_00320731 predicted 197
4 SASI_Hs02_00320732 predicted 533
5 SASI_Hs02_00320733 predicted 428
6 SASI_Hs02_00320734 predicted 566
7 SASI_Hs02_00320735 predicted 223
8 SASI_Hs02_00320736 predicted 1008
9 SASI_Hs02_00320737 predicted 1789
10 SASI_Hs02_00320738 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355708 predicted 369
2 SASI_Rn02_00355709 predicted 239
3 SASI_Rn02_00355710 predicted 238
4 SASI_Rn02_00355711 predicted 387
5 SASI_Rn02_00355712 predicted 374
6 SASI_Rn02_00355713 predicted 221
7 SASI_Rn02_00355714 predicted 207
8 SASI_Rn02_00355715 predicted 236
9 SASI_Rn02_00355716 predicted 220
10 SASI_Rn02_00355717 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427678 predicted 1091
2 SASI_Mm02_00427679 predicted 516
3 SASI_Mm01_00280665 predicted 450
4 SASI_Mm02_00427680 predicted 1202
5 SASI_Mm01_00280667 predicted 307
6 SASI_Mm02_00427681 predicted 857
7 SASI_Mm02_00427682 predicted 572
8 SASI_Mm01_00280668 predicted 895
9 SASI_Mm01_00280669 predicted 1580
10 SASI_Mm02_00427683 predicted 573
11 SASI_Mm01_00280664 predicted 213
12 SASI_Mm01_00280666 predicted 271
13 SASI_Mm01_00280670 predicted 1441
14 SASI_Mm01_00280671 predicted 226
15 SASI_Mm01_00280672 predicted 1058
16 SASI_Mm01_00280673 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444409 predicted 276
2 SASI_Mm02_00444410 predicted 530
3 SASI_Mm02_00444411 predicted 341
4 SASI_Mm02_00444412 predicted 384
5 SASI_Mm02_00444413 predicted 966
6 SASI_Mm02_00444414 predicted 1655
7 SASI_Mm02_00444415 predicted 658
8 SASI_Mm02_00444416 predicted 293
9 SASI_Mm02_00444417 predicted 1130
10 SASI_Mm02_00444418 predicted 734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015518
VALIDATED
ULK3 MISSION shRNA Bacterial Glycerol Stock
unc-51 like kinase 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000037419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_015518.1-367s1c1
Sequence:CCGGCGTGTCTTCATGCAGCAATTACTCGAGTAATTGCTGCATGAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015518.1-490s1c1
Sequence:CCGGGCAGACTTTGGTTTCGCACAACTCGAGTTGTGCGAAACCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015518.1-629s1c1
Sequence:CCGGTCCTGTATGGTGAGACCTCTTCTCGAGAAGAGGTCTCACCATACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015518.1-133s1c1
Sequence:CCGGACTCGTGAAGTGGTAGCCATACTCGAGTATGGCTACCACTTCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015518
VALIDATED
ULK3 MISSION shRNA shRNA Plasmid DNA
unc-51 like kinase 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000037419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_015518.1-367s1c1
Sequence:CCGGCGTGTCTTCATGCAGCAATTACTCGAGTAATTGCTGCATGAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015518.1-490s1c1
Sequence:CCGGGCAGACTTTGGTTTCGCACAACTCGAGTTGTGCGAAACCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015518.1-629s1c1
Sequence:CCGGTCCTGTATGGTGAGACCTCTTCTCGAGAAGAGGTCTCACCATACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015518.1-133s1c1
Sequence:CCGGACTCGTGAAGTGGTAGCCATACTCGAGTATGGCTACCACTTCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015518
VALIDATED
ULK3 MISSION shRNA Lentiviral Transduction Particles
unc-51 like kinase 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000037419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_015518.1-367s1c1
Sequence:CCGGCGTGTCTTCATGCAGCAATTACTCGAGTAATTGCTGCATGAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_015518.1-490s1c1
Sequence:CCGGGCAGACTTTGGTTTCGCACAACTCGAGTTGTGCGAAACCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015518.1-629s1c1
Sequence:CCGGTCCTGTATGGTGAGACCTCTTCTCGAGAAGAGGTCTCACCATACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015518.1-133s1c1
Sequence:CCGGACTCGTGAAGTGGTAGCCATACTCGAGTATGGCTACCACTTCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001127720
VALIDATED
ULK3 MISSION shRNA Bacterial Glycerol Stock
unc-51 like kinase 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000199903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:XM_001127720.1-1014s1c1
Sequence:CCGGGCAAGGCTCTGGACTTCTTTGCTCGAGCAAAGAAGTCCAGAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001127720.1-1366s1c1
Sequence:CCGGGCTTCACACTGAGGTTCAGAACTCGAGTTCTGAACCTCAGTGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:XM_001127720.1-271s1c1
Sequence:CCGGCACGGAGATTGAGATCCTCAACTCGAGTTGAGGATCTCAATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001127720.1-1694s1c1
Sequence:CCGGGTTTGATGGCTGTGCTGTATACTCGAGTATACAGCACAGCCATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001127720
VALIDATED
ULK3 MISSION shRNA shRNA Plasmid DNA
unc-51 like kinase 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000199903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:XM_001127720.1-1014s1c1
Sequence:CCGGGCAAGGCTCTGGACTTCTTTGCTCGAGCAAAGAAGTCCAGAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001127720.1-1366s1c1
Sequence:CCGGGCTTCACACTGAGGTTCAGAACTCGAGTTCTGAACCTCAGTGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:XM_001127720.1-271s1c1
Sequence:CCGGCACGGAGATTGAGATCCTCAACTCGAGTTGAGGATCTCAATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001127720.1-1694s1c1
Sequence:CCGGGTTTGATGGCTGTGCTGTATACTCGAGTATACAGCACAGCCATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001127720
VALIDATED
ULK3 MISSION shRNA Lentiviral Transduction Particles
unc-51 like kinase 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000199903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:XM_001127720.1-1014s1c1
Sequence:CCGGGCAAGGCTCTGGACTTCTTTGCTCGAGCAAAGAAGTCCAGAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001127720.1-1366s1c1
Sequence:CCGGGCTTCACACTGAGGTTCAGAACTCGAGTTCTGAACCTCAGTGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:XM_001127720.1-271s1c1
Sequence:CCGGCACGGAGATTGAGATCCTCAACTCGAGTTGAGGATCTCAATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001127720.1-1694s1c1
Sequence:CCGGGTTTGATGGCTGTGCTGTATACTCGAGTATACAGCACAGCCATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099436
ULK3 MISSION shRNA Bacterial Glycerol Stock
unc-51 like kinase 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000434293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-190s21c1
Sequence:CCGGGTACAAGGCCTACGCCAAGAACTCGAGTTCTTGGCGTAGGCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-1477s21c1
Sequence:CCGGCAAAGAGGGACTGTCGGAATCCTCGAGGATTCCGACAGTCCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-1522s21c1
Sequence:CCGGGTGACCCTAGAAGAATGATTGCTCGAGCAATCATTCTTCTAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-411s21c1
Sequence:CCGGTCATCCATACCCGCAGGATTCCTCGAGGAATCCTGCGGGTATGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099436
ULK3 MISSION shRNA shRNA Plasmid DNA
unc-51 like kinase 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000434293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-190s21c1
Sequence:CCGGGTACAAGGCCTACGCCAAGAACTCGAGTTCTTGGCGTAGGCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-1477s21c1
Sequence:CCGGCAAAGAGGGACTGTCGGAATCCTCGAGGATTCCGACAGTCCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-1522s21c1
Sequence:CCGGGTGACCCTAGAAGAATGATTGCTCGAGCAATCATTCTTCTAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-411s21c1
Sequence:CCGGTCATCCATACCCGCAGGATTCCTCGAGGAATCCTGCGGGTATGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099436
ULK3 MISSION shRNA Lentiviral Transduction Particles
unc-51 like kinase 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000434293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-190s21c1
Sequence:CCGGGTACAAGGCCTACGCCAAGAACTCGAGTTCTTGGCGTAGGCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-1477s21c1
Sequence:CCGGCAAAGAGGGACTGTCGGAATCCTCGAGGATTCCGACAGTCCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-1522s21c1
Sequence:CCGGGTGACCCTAGAAGAATGATTGCTCGAGCAATCATTCTTCTAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099436.1-411s21c1
Sequence:CCGGTCATCCATACCCGCAGGATTCCTCGAGGAATCCTGCGGGTATGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027895
ULK3 MISSION shRNA Bacterial Glycerol Stock
unc-51 like kinase 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000346931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-373s21c1
Sequence:CCGGCCAGTGGGACAATGACAATATCTCGAGATATTGTCATTGTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-244s21c1
Sequence:CCGGTCGGGAAGTGGTAGCCATAAACTCGAGTTTATGGCTACCACTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027895.1-1704s21c1
Sequence:CCGGTCTGGTGGCAGGTGTACTAAGCTCGAGCTTAGTACACCTGCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-1106s21c1
Sequence:CCGGCAGAGGAAGGAGGCAATTAAGCTCGAGCTTAATTGCCTCCTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027895
ULK3 MISSION shRNA shRNA Plasmid DNA
unc-51 like kinase 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000346931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-373s21c1
Sequence:CCGGCCAGTGGGACAATGACAATATCTCGAGATATTGTCATTGTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-244s21c1
Sequence:CCGGTCGGGAAGTGGTAGCCATAAACTCGAGTTTATGGCTACCACTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027895.1-1704s21c1
Sequence:CCGGTCTGGTGGCAGGTGTACTAAGCTCGAGCTTAGTACACCTGCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-1106s21c1
Sequence:CCGGCAGAGGAAGGAGGCAATTAAGCTCGAGCTTAATTGCCTCCTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027895
ULK3 MISSION shRNA Lentiviral Transduction Particles
unc-51 like kinase 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000346931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-373s21c1
Sequence:CCGGCCAGTGGGACAATGACAATATCTCGAGATATTGTCATTGTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-244s21c1
Sequence:CCGGTCGGGAAGTGGTAGCCATAAACTCGAGTTTATGGCTACCACTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027895.1-1704s21c1
Sequence:CCGGTCTGGTGGCAGGTGTACTAAGCTCGAGCTTAGTACACCTGCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027895.1-1106s21c1
Sequence:CCGGCAGAGGAAGGAGGCAATTAAGCTCGAGCTTAATTGCCTCCTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks