EMAIL THIS PAGE TO A FRIEND

ULK4

unc-51 like kinase 4

Synonyms: FAM7C1 REC01035
UniProtKB ID: Q96C45, A6NF15, Q8IW79, Q9NWV6, Q9UF96
Gene ID:
Mouse(209012) unc-51-like kinase 4
Rat(363167) unc-51 like kinase 4
Zebrafish(100332981) unc-51-like kinase 4 (C. elegans)
domestic cat(101082773) unc-51-like kinase 4 (C. elegans)
dog(477033) unc-51-like kinase 4 (C. elegans)
chicken(420713) unc-51-like kinase 4 (C. elegans)
domestic guinea pig(100734468) unc-51-like kinase 4 (C. elegans)
naked mole-rat(101722341) unc-51-like kinase 4 (C. elegans)
Domestic Rabbit(100352410) unc-51-like kinase 4 (C. elegans)
cow(100336480) CG8866-like
sheep(101115658) unc-51-like kinase 4 (C. elegans)
191 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017886 MISSION® shRNA Lentiviral Transduction Particles human pricing

siRNA Nano Scale

Product # Description Species Add to Cart
 
SIHK2429 MISSION® siRNA Human Kinase ULK4 (siRNA3), Nano Scale 0.25 nmol human pricing
SIHK2436 MISSION® siRNA Human Kinase ULK4 (siRNA1)0, Nano Scale 0.25 nmol human pricing
SIHK2444 MISSION® siRNA Human Kinase ULK4 (siRNA1)8, Nano Scale 0.25 nmol human pricing
SIHK2427 MISSION® siRNA Human Kinase ULK4 (siRNA1), Nano Scale 0.25 nmol human pricing
SIHK2428 MISSION® siRNA Human Kinase ULK4 (siRNA2), Nano Scale 0.25 nmol human pricing
SIHK2431 MISSION® siRNA Human Kinase ULK4 (siRNA5), Nano Scale 0.25 nmol human pricing
SIHK2432 MISSION® siRNA Human Kinase ULK4 (siRNA6), Nano Scale 0.25 nmol human pricing
SIHK2433 MISSION® siRNA Human Kinase ULK4 (siRNA7), Nano Scale 0.25 nmol human pricing
SIHK2434 MISSION® siRNA Human Kinase ULK4 (siRNA8), Nano Scale 0.25 nmol human pricing
SIHK2435 MISSION® siRNA Human Kinase ULK4 (siRNA9), Nano Scale 0.25 nmol human pricing
SIHK2437 MISSION® siRNA Human Kinase ULK4 (siRNA1)1, Nano Scale 0.25 nmol human pricing
SIHK2438 MISSION® siRNA Human Kinase ULK4 (siRNA1)2, Nano Scale 0.25 nmol human pricing
SIHK2439 MISSION® siRNA Human Kinase ULK4 (siRNA1)3, Nano Scale 0.25 nmol human pricing
SIHK2441 MISSION® siRNA Human Kinase ULK4 (siRNA1)5, Nano Scale 0.25 nmol human pricing
SIHK2442 MISSION® siRNA Human Kinase ULK4 (siRNA1)6, Nano Scale 0.25 nmol human pricing
SIHK2443 MISSION® siRNA Human Kinase ULK4 (siRNA1)7, Nano Scale 0.25 nmol human pricing
SIHK2445 MISSION® siRNA Human Kinase ULK4 (siRNA1)9, Nano Scale 0.25 nmol human pricing
SIHK2446 MISSION® siRNA Human Kinase ULK4 (siRNA2)0, Nano Scale 0.25 nmol human pricing
SIHK2447 MISSION® siRNA Human Kinase ULK4 (siRNA2)1, Nano Scale 0.25 nmol human pricing
SIHK2448 MISSION® siRNA Human Kinase ULK4 (siRNA2)2, Nano Scale 0.25 nmol human pricing
SIHK2430 MISSION® siRNA Human Kinase ULK4 (siRNA4), Nano Scale 0.25 nmol human pricing
SIHK2440 MISSION® siRNA Human Kinase ULK4 (siRNA1)4, Nano Scale 0.25 nmol human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017886 Rosetta Predictions human pricing
XM_929989 Rosetta Predictions human pricing
XM_934158 Rosetta Predictions human pricing
XM_934164 Rosetta Predictions human pricing
XM_934167 Rosetta Predictions human pricing
XM_934168 Rosetta Predictions human pricing
XM_934169 Rosetta Predictions human pricing
XM_934170 Rosetta Predictions human pricing
XM_934171 Rosetta Predictions human pricing
XM_934172 Rosetta Predictions human pricing
XM_934174 Rosetta Predictions human pricing
XM_001077978 Rosetta Predictions rat pricing
XM_343506 Rosetta Predictions rat pricing
XM_001479566 Rosetta Predictions mouse pricing
XM_001481114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350835 predicted 1529
2 SASI_Hs02_00350836 predicted 1489
3 SASI_Hs02_00350837 predicted 3557
4 SASI_Hs02_00350838 predicted 2423
5 SASI_Hs02_00350839 predicted 2817
6 SASI_Hs02_00350840 predicted 1215
7 SASI_Hs02_00350841 predicted 1196
8 SASI_Hs02_00350842 predicted 521
9 SASI_Hs02_00350843 predicted 1323
10 SASI_Hs02_00350844 predicted 2671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267269 predicted 823
2 SASI_Hs01_00267270 predicted 2651
3 SASI_Hs01_00267271 predicted 785
4 SASI_Hs01_00267272 predicted 2856
5 SASI_Hs01_00267273 predicted 1732
6 SASI_Hs01_00267274 predicted 2117
7 SASI_Hs01_00267275 predicted 514
8 SASI_Hs01_00267276 predicted 616
9 SASI_Hs01_00267277 predicted 1973
10 SASI_Hs01_00267278 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298236 predicted 244
2 SASI_Hs01_00298237 predicted 250
3 SASI_Hs01_00298238 predicted 225
4 SASI_Hs01_00298239 predicted 210
5 SASI_Hs01_00298240 predicted 249
6 SASI_Hs01_00298241 predicted 242
7 SASI_Hs01_00298242 predicted 219
8 SASI_Hs01_00298243 predicted 208
9 SASI_Hs01_00298244 predicted 227
10 SASI_Hs01_00298245 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274768 predicted 823
2 SASI_Hs01_00274769 predicted 792
3 SASI_Hs01_00274770 predicted 558
4 SASI_Hs01_00274771 predicted 670
5 SASI_Hs01_00274772 predicted 520
6 SASI_Hs01_00274773 predicted 901
7 SASI_Hs01_00274774 predicted 621
8 SASI_Hs01_00274775 predicted 610
9 SASI_Hs01_00274776 predicted 589
10 SASI_Hs01_00274777 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283614 predicted 830
2 SASI_Hs01_00283615 predicted 786
3 SASI_Hs01_00283616 predicted 565
4 SASI_Hs01_00283617 predicted 671
5 SASI_Hs01_00283618 predicted 521
6 SASI_Hs01_00283619 predicted 908
7 SASI_Hs01_00283620 predicted 618
8 SASI_Hs01_00283621 predicted 601
9 SASI_Hs01_00283622 predicted 581
10 SASI_Hs01_00283623 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262996 predicted 772
2 SASI_Hs01_00262997 predicted 548
3 SASI_Hs01_00262998 predicted 775
4 SASI_Hs01_00262999 predicted 778
5 SASI_Hs01_00263000 predicted 514
6 SASI_Hs01_00263001 predicted 634
7 SASI_Hs01_00263002 predicted 529
8 SASI_Hs01_00263003 predicted 533
9 SASI_Hs01_00263004 predicted 663
10 SASI_Hs01_00263005 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289480 predicted 1444
2 SASI_Hs01_00289481 predicted 1400
3 SASI_Hs01_00289482 predicted 1179
4 SASI_Hs01_00289483 predicted 795
5 SASI_Hs01_00289484 predicted 506
6 SASI_Hs01_00289485 predicted 1136
7 SASI_Hs01_00289486 predicted 1108
8 SASI_Hs01_00289487 predicted 433
9 SASI_Hs01_00289488 predicted 1238
10 SASI_Hs01_00289489 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285210 predicted 218
2 SASI_Hs01_00285211 predicted 218
3 SASI_Hs01_00285212 predicted 219
4 SASI_Hs01_00285213 predicted 164
5 SASI_Hs01_00285214 predicted 413
6 SASI_Hs01_00285215 predicted 410
7 SASI_Hs01_00285216 predicted 197
8 SASI_Hs01_00285217 predicted 372
9 SASI_Hs01_00285218 predicted 381
10 SASI_Hs01_00285219 predicted 167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258013 predicted 394
2 SASI_Hs01_00258014 predicted 434
3 SASI_Hs01_00258015 predicted 435
4 SASI_Hs01_00258016 predicted 421
5 SASI_Hs01_00258017 predicted 433
6 SASI_Hs01_00258018 predicted 320
7 SASI_Hs01_00258019 predicted 346
8 SASI_Hs01_00258020 predicted 436
9 SASI_Hs01_00258021 predicted 406
10 SASI_Hs01_00258022 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257102 predicted 1419
2 SASI_Hs01_00257103 predicted 1378
3 SASI_Hs01_00257104 predicted 1150
4 SASI_Hs01_00257105 predicted 781
5 SASI_Hs01_00257106 predicted 486
6 SASI_Hs01_00257107 predicted 1104
7 SASI_Hs01_00257108 predicted 1081
8 SASI_Hs01_00257109 predicted 403
9 SASI_Hs01_00257110 predicted 1208
10 SASI_Hs01_00257111 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262879 predicted 1442
2 SASI_Hs01_00262880 predicted 1408
3 SASI_Hs01_00262881 predicted 1179
4 SASI_Hs01_00262882 predicted 799
5 SASI_Hs01_00262883 predicted 515
6 SASI_Hs01_00262884 predicted 1136
7 SASI_Hs01_00262885 predicted 1114
8 SASI_Hs01_00262886 predicted 433
9 SASI_Hs01_00262887 predicted 1234
10 SASI_Hs01_00262888 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359181 predicted 2631
2 SASI_Rn02_00359182 predicted 2456
3 SASI_Rn02_00359183 predicted 2621
4 SASI_Rn02_00359184 predicted 3560
5 SASI_Rn02_00359185 predicted 2843
6 SASI_Rn02_00359186 predicted 2161
7 SASI_Rn02_00359187 predicted 1264
8 SASI_Rn02_00359188 predicted 3679
9 SASI_Rn02_00359189 predicted 658
10 SASI_Rn02_00359190 predicted 2725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395924 predicted 3299
2 SASI_Rn02_00395925 predicted 3229
3 SASI_Rn02_00395926 predicted 3606
4 SASI_Rn02_00395927 predicted 3567
5 SASI_Rn02_00395928 predicted 2800
6 SASI_Rn02_00395929 predicted 2845
7 SASI_Rn02_00395930 predicted 3679
8 SASI_Rn02_00395931 predicted 3177
9 SASI_Rn02_00395932 predicted 2824
10 SASI_Rn02_00395933 predicted 3151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410972 predicted 1520
2 SASI_Mm02_00410973 predicted 3102
3 SASI_Mm02_00410974 predicted 3700
4 SASI_Mm02_00410975 predicted 713
5 SASI_Mm02_00410976 predicted 1614
6 SASI_Mm02_00410977 predicted 2099
7 SASI_Mm02_00410978 predicted 3099
8 SASI_Mm02_00410979 predicted 1381
9 SASI_Mm02_00410980 predicted 3292
10 SASI_Mm02_00410981 predicted 4156
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00422206 predicted 2523
2 SASI_Mm02_00422207 predicted 2431
3 SASI_Mm02_00422208 predicted 2497
4 SASI_Mm02_00422209 predicted 2435
5 SASI_Mm02_00422210 predicted 2443
6 SASI_Mm02_00422211 predicted 2528
7 SASI_Mm02_00422212 predicted 2487
8 SASI_Mm02_00422213 predicted 2497
9 SASI_Mm02_00422214 predicted 2447
10 SASI_Mm02_00422215 predicted 2409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177589
ULK4 MISSION shRNA Bacterial Glycerol Stock
unc-51 like kinase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-2933s21c1
Sequence:CCGGGCTCGACGGTCATGGATTATACTCGAGTATAATCCATGACCGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-1217s21c1
Sequence:CCGGAGCTGAATGAATCCATATTTCCTCGAGGAAATATGGATTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-197s21c1
Sequence:CCGGGAAGCAGGACTGTCGTATATACTCGAGTATATACGACAGTCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-2033s21c1
Sequence:CCGGCTGCGAAGATTATCGAGAATGCTCGAGCATTCTCGATAATCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-1430s21c1
Sequence:CCGGTTATAGACAATCCGAAGATAACTCGAGTTATCTTCGGATTGTCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177589
ULK4 MISSION shRNA shRNA Plasmid DNA
unc-51 like kinase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-2933s21c1
Sequence:CCGGGCTCGACGGTCATGGATTATACTCGAGTATAATCCATGACCGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-1217s21c1
Sequence:CCGGAGCTGAATGAATCCATATTTCCTCGAGGAAATATGGATTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-197s21c1
Sequence:CCGGGAAGCAGGACTGTCGTATATACTCGAGTATATACGACAGTCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-2033s21c1
Sequence:CCGGCTGCGAAGATTATCGAGAATGCTCGAGCATTCTCGATAATCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-1430s21c1
Sequence:CCGGTTATAGACAATCCGAAGATAACTCGAGTTATCTTCGGATTGTCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177589
ULK4 MISSION shRNA Lentiviral Transduction Particles
unc-51 like kinase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-2933s21c1
Sequence:CCGGGCTCGACGGTCATGGATTATACTCGAGTATAATCCATGACCGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-1217s21c1
Sequence:CCGGAGCTGAATGAATCCATATTTCCTCGAGGAAATATGGATTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-197s21c1
Sequence:CCGGGAAGCAGGACTGTCGTATATACTCGAGTATATACGACAGTCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-2033s21c1
Sequence:CCGGCTGCGAAGATTATCGAGAATGCTCGAGCATTCTCGATAATCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177589.3-1430s21c1
Sequence:CCGGTTATAGACAATCCGAAGATAACTCGAGTTATCTTCGGATTGTCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017886
ULK4 MISSION shRNA Bacterial Glycerol Stock
unc-51 like kinase 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-251s1c1
Sequence:CCGGGTCCGTCTCACCCGTGAAATACTCGAGTATTTCACGGGTGAGACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-812s1c1
Sequence:CCGGGAAGATCCTTTGCCACCTATTCTCGAGAATAGGTGGCAAAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-1133s1c1
Sequence:CCGGCCAACTGAGTTTCGGCCTAAGCTCGAGCTTAGGCCGAAACTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017886.1-1758s1c1
Sequence:CCGGCCTGTTGTTGAGGCAATTGTTCTCGAGAACAATTGCCTCAACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017886.1-204s1c1
Sequence:CCGGCCATTCTTTGTACTGATAAGTCTCGAGACTTATCAGTACAAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017886.1-1278s1c1
Sequence:CCGGCTTCTCCTCTGACCAAGATTACTCGAGTAATCTTGGTCAGAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-432s1c1
Sequence:CCGGGTGGATTACATCATCTTCATACTCGAGTATGAAGATGATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017886.1-2234s1c1
Sequence:CCGGGCAGTACATGTTGACCTTATTCTCGAGAATAAGGTCAACATGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-422s1c1
Sequence:CCGGGACCTGATTAGTGGATTACATCTCGAGATGTAATCCACTAATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-1103s1c1
Sequence:CCGGCCACTAGGTCACTCTTTCAGACTCGAGTCTGAAAGAGTGACCTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-176s1c1
Sequence:CCGGCGACGGAAGGGAACAATCAATCTCGAGATTGATTGTTCCCTTCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-393s1c1
Sequence:CCGGCAGAAGATGTTGTGAGAGAATCTCGAGATTCTCTCACAACATCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017886.x-2034s1c1
Sequence:CCGGCAGGGCTTTATTACAGGAGAACTCGAGTTCTCCTGTAATAAAGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017886
ULK4 MISSION shRNA shRNA Plasmid DNA
unc-51 like kinase 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-251s1c1
Sequence:CCGGGTCCGTCTCACCCGTGAAATACTCGAGTATTTCACGGGTGAGACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-812s1c1
Sequence:CCGGGAAGATCCTTTGCCACCTATTCTCGAGAATAGGTGGCAAAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-1133s1c1
Sequence:CCGGCCAACTGAGTTTCGGCCTAAGCTCGAGCTTAGGCCGAAACTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017886.1-1758s1c1
Sequence:CCGGCCTGTTGTTGAGGCAATTGTTCTCGAGAACAATTGCCTCAACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017886.1-204s1c1
Sequence:CCGGCCATTCTTTGTACTGATAAGTCTCGAGACTTATCAGTACAAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017886.1-1278s1c1
Sequence:CCGGCTTCTCCTCTGACCAAGATTACTCGAGTAATCTTGGTCAGAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-432s1c1
Sequence:CCGGGTGGATTACATCATCTTCATACTCGAGTATGAAGATGATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017886.1-2234s1c1
Sequence:CCGGGCAGTACATGTTGACCTTATTCTCGAGAATAAGGTCAACATGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-422s1c1
Sequence:CCGGGACCTGATTAGTGGATTACATCTCGAGATGTAATCCACTAATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-1103s1c1
Sequence:CCGGCCACTAGGTCACTCTTTCAGACTCGAGTCTGAAAGAGTGACCTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-176s1c1
Sequence:CCGGCGACGGAAGGGAACAATCAATCTCGAGATTGATTGTTCCCTTCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-393s1c1
Sequence:CCGGCAGAAGATGTTGTGAGAGAATCTCGAGATTCTCTCACAACATCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017886.x-2034s1c1
Sequence:CCGGCAGGGCTTTATTACAGGAGAACTCGAGTTCTCCTGTAATAAAGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017886
ULK4 MISSION shRNA Lentiviral Transduction Particles
unc-51 like kinase 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-251s1c1
Sequence:CCGGGTCCGTCTCACCCGTGAAATACTCGAGTATTTCACGGGTGAGACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-812s1c1
Sequence:CCGGGAAGATCCTTTGCCACCTATTCTCGAGAATAGGTGGCAAAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-1133s1c1
Sequence:CCGGCCAACTGAGTTTCGGCCTAAGCTCGAGCTTAGGCCGAAACTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017886.1-1758s1c1
Sequence:CCGGCCTGTTGTTGAGGCAATTGTTCTCGAGAACAATTGCCTCAACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017886.1-204s1c1
Sequence:CCGGCCATTCTTTGTACTGATAAGTCTCGAGACTTATCAGTACAAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017886.1-1278s1c1
Sequence:CCGGCTTCTCCTCTGACCAAGATTACTCGAGTAATCTTGGTCAGAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.1-432s1c1
Sequence:CCGGGTGGATTACATCATCTTCATACTCGAGTATGAAGATGATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017886.1-2234s1c1
Sequence:CCGGGCAGTACATGTTGACCTTATTCTCGAGAATAAGGTCAACATGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-422s1c1
Sequence:CCGGGACCTGATTAGTGGATTACATCTCGAGATGTAATCCACTAATCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-1103s1c1
Sequence:CCGGCCACTAGGTCACTCTTTCAGACTCGAGTCTGAAAGAGTGACCTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-176s1c1
Sequence:CCGGCGACGGAAGGGAACAATCAATCTCGAGATTGATTGTTCCCTTCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017886.x-393s1c1
Sequence:CCGGCAGAAGATGTTGTGAGAGAATCTCGAGATTCTCTCACAACATCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017886.x-2034s1c1
Sequence:CCGGCAGGGCTTTATTACAGGAGAACTCGAGTTCTCCTGTAATAAAGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks