EMAIL THIS PAGE TO A FRIEND

UMOD

uromodulin

Synonyms: ADMCKD2 FJHN HNFJ HNFJ1 MCKD2 THGP THP
UniProtKB ID: P07911, B3KP48, B3KRN9, Q540J6, Q6ZS84, Q8IYG0
Gene ID:
Human(7369) Summary: The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situated on the luminal cell surface of the loop of Henle. This protein may act as a constitutive inhibitor of calcium crystallization in renal fluids. Excretion of this protein in urine may provide defense against urinary tract infections caused by uropathogenic bacteria. Defects in this gene are associated with the renal disorders medullary cystic kidney disease-2 (MCKD2), glomerulocystic kidney disease with hyperuricemia and isosthenuria (GCKDHI), and familial juvenile hyperuricemic nephropathy (FJHN). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(22242) uromodulin
Rat(25128) uromodulin
dog(403510) uromodulin
cow(281567) uromodulin
sheep(101119604) uromodulin
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0751 Human UMOD / Uromodulin ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003361 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121041 MISSION® esiRNA esiRNA human UMOD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008389 Rosetta Predictions human pricing
NM_003361 Rosetta Predictions human pricing
NM_017082 Rosetta Predictions rat pricing
NM_009470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026544 predicted 1379
2 SASI_Hs01_00026545 predicted 293
3 SASI_Hs01_00026546 predicted 1276
4 SASI_Hs02_00305416 predicted 1638
5 SASI_Hs01_00026547 predicted 1820
6 SASI_Hs01_00026548 predicted 1798
7 SASI_Hs01_00026549 predicted 1733
8 SASI_Hs01_00026550 predicted 1743
9 SASI_Hs01_00026551 predicted 1641
10 SASI_Hs01_00026552 predicted 1246
11 SASI_Hs01_00026553 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024220 predicted 1442
2 SASI_Hs01_00024221 predicted 356
3 SASI_Hs01_00024222 predicted 1341
4 SASI_Hs02_00335511 predicted 1701
5 SASI_Hs01_00024223 predicted 1886
6 SASI_Hs01_00024224 predicted 1861
7 SASI_Hs01_00024225 predicted 1791
8 SASI_Hs01_00024226 predicted 1808
9 SASI_Hs01_00024227 predicted 1709
10 SASI_Hs01_00024228 predicted 1307
11 SASI_Hs01_00024229 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121892 predicted 1298
2 SASI_Rn01_00121893 predicted 1317
3 SASI_Rn02_00261294 predicted 1940
4 SASI_Rn01_00121894 predicted 1269
5 SASI_Rn01_00121895 predicted 1624
6 SASI_Rn02_00261295 predicted 1301
7 SASI_Rn01_00121897 predicted 591
8 SASI_Rn01_00121898 predicted 1928
9 SASI_Rn01_00121899 predicted 1745
10 SASI_Rn01_00121900 predicted 1352
11 SASI_Rn01_00121896 predicted 1529
12 SASI_Rn01_00121901 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021419 predicted 1456
2 SASI_Mm01_00021421 predicted 1788
3 SASI_Mm01_00021422 predicted 1695
4 SASI_Mm01_00021423 predicted 2184
5 SASI_Mm01_00021424 predicted 1967
6 SASI_Mm01_00021425 predicted 1989
7 SASI_Mm02_00316195 predicted 2107
8 SASI_Mm01_00021426 predicted 1467
9 SASI_Mm01_00021427 predicted 1834
10 SASI_Mm02_00316196 predicted 1857
11 SASI_Mm01_00021420 predicted 2098
12 SASI_Mm01_00021428 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003361
UMOD MISSION shRNA Bacterial Glycerol Stock
uromodulin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003361.2-2156s1c1
Sequence:CCGGCTTTGTTCAGCCTGCCTTCTTCTCGAGAAGAAGGCAGGCTGAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1046s1c1
Sequence:CCGGGCAAATCGAATAATGGCAGATCTCGAGATCTGCCATTATTCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1895s1c1
Sequence:CCGGGTGGGAGTGTCATAGATCAATCTCGAGATTGATCTATGACACTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1350s1c1
Sequence:CCGGCCTGGCAGATGAGATCATCATCTCGAGATGATGATCTCATCTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003361.2-200s1c1
Sequence:CCGGCTGACACCTCAGAAGCAAGATCTCGAGATCTTGCTTCTGAGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003361.2-172s1c1
Sequence:CCGGGCCTCTTGGTTCATCACAACTCTCGAGAGTTGTGATGAACCAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1362s1c1
Sequence:CCGGGATCATCATCCGTGACCTCAACTCGAGTTGAGGTCACGGATGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1714s21c1
Sequence:CCGGCACACTAGAGACTCAACTATCCTCGAGGATAGTTGAGTCTCTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1450s21c1
Sequence:CCGGCCAATGGTCAGTGCTCTAAACCTCGAGGTTTAGAGCACTGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1787s21c1
Sequence:CCGGTCCGGTTTGCTGGAAACTATGCTCGAGCATAGTTTCCAGCAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003361
UMOD MISSION shRNA shRNA Plasmid DNA
uromodulin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003361.2-2156s1c1
Sequence:CCGGCTTTGTTCAGCCTGCCTTCTTCTCGAGAAGAAGGCAGGCTGAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1046s1c1
Sequence:CCGGGCAAATCGAATAATGGCAGATCTCGAGATCTGCCATTATTCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1895s1c1
Sequence:CCGGGTGGGAGTGTCATAGATCAATCTCGAGATTGATCTATGACACTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1350s1c1
Sequence:CCGGCCTGGCAGATGAGATCATCATCTCGAGATGATGATCTCATCTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003361.2-200s1c1
Sequence:CCGGCTGACACCTCAGAAGCAAGATCTCGAGATCTTGCTTCTGAGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003361.2-172s1c1
Sequence:CCGGGCCTCTTGGTTCATCACAACTCTCGAGAGTTGTGATGAACCAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1362s1c1
Sequence:CCGGGATCATCATCCGTGACCTCAACTCGAGTTGAGGTCACGGATGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1714s21c1
Sequence:CCGGCACACTAGAGACTCAACTATCCTCGAGGATAGTTGAGTCTCTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1450s21c1
Sequence:CCGGCCAATGGTCAGTGCTCTAAACCTCGAGGTTTAGAGCACTGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1787s21c1
Sequence:CCGGTCCGGTTTGCTGGAAACTATGCTCGAGCATAGTTTCCAGCAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003361
UMOD MISSION shRNA Lentiviral Transduction Particles
uromodulin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003361.2-2156s1c1
Sequence:CCGGCTTTGTTCAGCCTGCCTTCTTCTCGAGAAGAAGGCAGGCTGAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1046s1c1
Sequence:CCGGGCAAATCGAATAATGGCAGATCTCGAGATCTGCCATTATTCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1895s1c1
Sequence:CCGGGTGGGAGTGTCATAGATCAATCTCGAGATTGATCTATGACACTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1350s1c1
Sequence:CCGGCCTGGCAGATGAGATCATCATCTCGAGATGATGATCTCATCTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003361.2-200s1c1
Sequence:CCGGCTGACACCTCAGAAGCAAGATCTCGAGATCTTGCTTCTGAGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003361.2-172s1c1
Sequence:CCGGGCCTCTTGGTTCATCACAACTCTCGAGAGTTGTGATGAACCAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003361.2-1362s1c1
Sequence:CCGGGATCATCATCCGTGACCTCAACTCGAGTTGAGGTCACGGATGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1714s21c1
Sequence:CCGGCACACTAGAGACTCAACTATCCTCGAGGATAGTTGAGTCTCTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1450s21c1
Sequence:CCGGCCAATGGTCAGTGCTCTAAACCTCGAGGTTTAGAGCACTGACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003361.2-1787s21c1
Sequence:CCGGTCCGGTTTGCTGGAAACTATGCTCGAGCATAGTTTCCAGCAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009470
UMOD MISSION shRNA Bacterial Glycerol Stock
uromodulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009470.2-2229s1c1
Sequence:CCGGGCTTGCACGTACTCTTTCTTTCTCGAGAAAGAAAGAGTACGTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1417s1c1
Sequence:CCGGCCTGGCAAATGCGATCATCATCTCGAGATGATGATCGCATTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1683s1c1
Sequence:CCGGTGTCCCGGTTTGTACTGCTAACTCGAGTTAGCAGTACAAACCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1958s1c1
Sequence:CCGGCGAAGTGGGAACTTCATAGATCTCGAGATCTATGAAGTTCCCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-286s1c1
Sequence:CCGGGTGTTCTGAATGCCACAACAACTCGAGTTGTTGTGGCATTCAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009470
UMOD MISSION shRNA shRNA Plasmid DNA
uromodulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009470.2-2229s1c1
Sequence:CCGGGCTTGCACGTACTCTTTCTTTCTCGAGAAAGAAAGAGTACGTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1417s1c1
Sequence:CCGGCCTGGCAAATGCGATCATCATCTCGAGATGATGATCGCATTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1683s1c1
Sequence:CCGGTGTCCCGGTTTGTACTGCTAACTCGAGTTAGCAGTACAAACCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1958s1c1
Sequence:CCGGCGAAGTGGGAACTTCATAGATCTCGAGATCTATGAAGTTCCCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-286s1c1
Sequence:CCGGGTGTTCTGAATGCCACAACAACTCGAGTTGTTGTGGCATTCAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009470
UMOD MISSION shRNA Lentiviral Transduction Particles
uromodulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009470.2-2229s1c1
Sequence:CCGGGCTTGCACGTACTCTTTCTTTCTCGAGAAAGAAAGAGTACGTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1417s1c1
Sequence:CCGGCCTGGCAAATGCGATCATCATCTCGAGATGATGATCGCATTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1683s1c1
Sequence:CCGGTGTCCCGGTTTGTACTGCTAACTCGAGTTAGCAGTACAAACCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-1958s1c1
Sequence:CCGGCGAAGTGGGAACTTCATAGATCTCGAGATCTATGAAGTTCCCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009470.2-286s1c1
Sequence:CCGGGTGTTCTGAATGCCACAACAACTCGAGTTGTTGTGGCATTCAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks