EMAIL THIS PAGE TO A FRIEND

UMODL1

uromodulin-like 1

UniProtKB ID: Q5DID0, C9JCE6, Q5DIC9, Q6LA40, Q6LA41, Q8N216
Gene ID:
Mouse(52020) uromodulin-like 1
Rat(365544) uromodulin-like 1
domestic guinea pig(100732637) uromodulin-like 1
naked mole-rat(101718526) uromodulin-like 1
cow(524189) uromodulin-like 1
sheep(101121234) uromodulin-like 1
Zebrafish(567806) uromodulin-like 1
Horse(100058147) uromodulin-like 1
domestic cat(101094529) uromodulin-like 1
dog(487776) uromodulin-like 1
chicken(427987) uromodulin-like 1
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004416 Rosetta Predictions human pricing
NM_173568 Rosetta Predictions human pricing
XM_001079051 Rosetta Predictions rat pricing
XM_345087 Rosetta Predictions rat pricing
NM_177465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163405 predicted 3587
2 SASI_Hs01_00163407 predicted 739
3 SASI_Hs02_00304579 predicted 983
4 SASI_Hs02_00304580 predicted 209
5 SASI_Hs01_00163409 predicted 3802
6 SASI_Hs01_00163410 predicted 3986
7 SASI_Hs01_00163411 predicted 504
8 SASI_Hs01_00163412 predicted 2437
9 SASI_Hs01_00163413 predicted 2115
10 SASI_Hs01_00163414 predicted 3806
11 SASI_Hs01_00163406 predicted 993
12 SASI_Hs01_00163408 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061150 predicted 3972
2 SASI_Hs01_00061152 predicted 741
3 SASI_Hs02_00368398 predicted 984
4 SASI_Hs02_00368399 predicted 203
5 SASI_Hs01_00061154 predicted 4184
6 SASI_Hs01_00061155 predicted 4361
7 SASI_Hs01_00061156 predicted 504
8 SASI_Hs01_00061157 predicted 2819
9 SASI_Hs01_00061158 predicted 2504
10 SASI_Hs01_00061159 predicted 4187
11 SASI_Hs01_00061151 predicted 1000
12 SASI_Hs01_00061153 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363015 predicted 2774
2 SASI_Rn02_00363016 predicted 471
3 SASI_Rn02_00363017 predicted 1738
4 SASI_Rn02_00363018 predicted 4004
5 SASI_Rn02_00363019 predicted 1723
6 SASI_Rn02_00363020 predicted 2705
7 SASI_Rn02_00363021 predicted 2173
8 SASI_Rn02_00363022 predicted 2405
9 SASI_Rn02_00363023 predicted 3896
10 SASI_Rn02_00363024 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397957 predicted 2765
2 SASI_Rn02_00397958 predicted 469
3 SASI_Rn02_00397959 predicted 4067
4 SASI_Rn02_00397960 predicted 1725
5 SASI_Rn02_00397961 predicted 3771
6 SASI_Rn02_00397962 predicted 3190
7 SASI_Rn02_00397963 predicted 1706
8 SASI_Rn02_00397964 predicted 2687
9 SASI_Rn02_00397965 predicted 3971
10 SASI_Rn02_00397966 predicted 4082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033338 predicted 440
2 SASI_Mm02_00347667 predicted 1882
3 SASI_Mm01_00033339 predicted 1045
4 SASI_Mm02_00347668 predicted 3913
5 SASI_Mm01_00033340 predicted 3662
6 SASI_Mm01_00033341 predicted 2734
7 SASI_Mm01_00033342 predicted 1055
8 SASI_Mm01_00033344 predicted 685
9 SASI_Mm01_00033345 predicted 1988
10 SASI_Mm02_00347669 predicted 2183
11 SASI_Mm01_00033337 predicted 1157
12 SASI_Mm01_00033343 predicted 3427
13 SASI_Mm01_00033346 predicted 1037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177465
UMODL1 MISSION shRNA Bacterial Glycerol Stock
uromodulin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2059s1c1
Sequence:CCGGGCCAGCGATGAGATCAAGATTCTCGAGAATCTTGATCTCATCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2166s1c1
Sequence:CCGGCGTAACCTTCAGCTTCATCAACTCGAGTTGATGAAGCTGAAGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177465.2-3279s1c1
Sequence:CCGGCCTCTACTTTGTTGATTTGAACTCGAGTTCAAATCAACAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-1450s1c1
Sequence:CCGGCCTGACTCACAGGTGGAATATCTCGAGATATTCCACCTGTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2553s1c1
Sequence:CCGGGCAGAAATACAATCTTCGGATCTCGAGATCCGAAGATTGTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177465
UMODL1 MISSION shRNA shRNA Plasmid DNA
uromodulin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2059s1c1
Sequence:CCGGGCCAGCGATGAGATCAAGATTCTCGAGAATCTTGATCTCATCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2166s1c1
Sequence:CCGGCGTAACCTTCAGCTTCATCAACTCGAGTTGATGAAGCTGAAGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177465.2-3279s1c1
Sequence:CCGGCCTCTACTTTGTTGATTTGAACTCGAGTTCAAATCAACAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-1450s1c1
Sequence:CCGGCCTGACTCACAGGTGGAATATCTCGAGATATTCCACCTGTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2553s1c1
Sequence:CCGGGCAGAAATACAATCTTCGGATCTCGAGATCCGAAGATTGTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177465
UMODL1 MISSION shRNA Lentiviral Transduction Particles
uromodulin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2059s1c1
Sequence:CCGGGCCAGCGATGAGATCAAGATTCTCGAGAATCTTGATCTCATCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2166s1c1
Sequence:CCGGCGTAACCTTCAGCTTCATCAACTCGAGTTGATGAAGCTGAAGGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177465.2-3279s1c1
Sequence:CCGGCCTCTACTTTGTTGATTTGAACTCGAGTTCAAATCAACAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-1450s1c1
Sequence:CCGGCCTGACTCACAGGTGGAATATCTCGAGATATTCCACCTGTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177465.2-2553s1c1
Sequence:CCGGGCAGAAATACAATCTTCGGATCTCGAGATCCGAAGATTGTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173568
UMODL1 MISSION shRNA Bacterial Glycerol Stock
uromodulin-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-579s1c1
Sequence:CCGGGTTACCGAAATGCAGTTGTTTCTCGAGAAACAACTGCATTTCGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-1178s1c1
Sequence:CCGGCTACCAGGTGTTCTACGAATACTCGAGTATTCGTAGAACACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-785s1c1
Sequence:CCGGCAACACATACACCAACGTGATCTCGAGATCACGTTGGTGTATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-830s1c1
Sequence:CCGGCCAGTTCAAGCTGAGGATCTTCTCGAGAAGATCCTCAGCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-618s1c1
Sequence:CCGGCCTCAGAATTATAGCGTGTCTCTCGAGAGACACGCTATAATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173568
UMODL1 MISSION shRNA shRNA Plasmid DNA
uromodulin-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-579s1c1
Sequence:CCGGGTTACCGAAATGCAGTTGTTTCTCGAGAAACAACTGCATTTCGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-1178s1c1
Sequence:CCGGCTACCAGGTGTTCTACGAATACTCGAGTATTCGTAGAACACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-785s1c1
Sequence:CCGGCAACACATACACCAACGTGATCTCGAGATCACGTTGGTGTATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-830s1c1
Sequence:CCGGCCAGTTCAAGCTGAGGATCTTCTCGAGAAGATCCTCAGCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-618s1c1
Sequence:CCGGCCTCAGAATTATAGCGTGTCTCTCGAGAGACACGCTATAATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173568
UMODL1 MISSION shRNA Lentiviral Transduction Particles
uromodulin-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-579s1c1
Sequence:CCGGGTTACCGAAATGCAGTTGTTTCTCGAGAAACAACTGCATTTCGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-1178s1c1
Sequence:CCGGCTACCAGGTGTTCTACGAATACTCGAGTATTCGTAGAACACCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-785s1c1
Sequence:CCGGCAACACATACACCAACGTGATCTCGAGATCACGTTGGTGTATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-830s1c1
Sequence:CCGGCCAGTTCAAGCTGAGGATCTTCTCGAGAAGATCCTCAGCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173568.1-618s1c1
Sequence:CCGGCCTCAGAATTATAGCGTGTCTCTCGAGAGACACGCTATAATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004416
UMODL1 MISSION shRNA Bacterial Glycerol Stock
uromodulin-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-3988s1c1
Sequence:CCGGGCCGGTTATGTGGTCCTTATTCTCGAGAATAAGGACCACATAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-2553s1c1
Sequence:CCGGGCTCATTGGAAAGGTCAGAATCTCGAGATTCTGACCTTTCCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004416.1-4250s1c1
Sequence:CCGGCCTCGGTTCTTAACTCTTCAACTCGAGTTGAAGAGTTAAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-4098s1c1
Sequence:CCGGCCAGTCCAACAACTTCAGCTACTCGAGTAGCTGAAGTTGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-2853s1c1
Sequence:CCGGCGACACCTTCATACAGGATTACTCGAGTAATCCTGTATGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004416
UMODL1 MISSION shRNA shRNA Plasmid DNA
uromodulin-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-3988s1c1
Sequence:CCGGGCCGGTTATGTGGTCCTTATTCTCGAGAATAAGGACCACATAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-2553s1c1
Sequence:CCGGGCTCATTGGAAAGGTCAGAATCTCGAGATTCTGACCTTTCCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004416.1-4250s1c1
Sequence:CCGGCCTCGGTTCTTAACTCTTCAACTCGAGTTGAAGAGTTAAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-4098s1c1
Sequence:CCGGCCAGTCCAACAACTTCAGCTACTCGAGTAGCTGAAGTTGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-2853s1c1
Sequence:CCGGCGACACCTTCATACAGGATTACTCGAGTAATCCTGTATGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004416
UMODL1 MISSION shRNA Lentiviral Transduction Particles
uromodulin-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-3988s1c1
Sequence:CCGGGCCGGTTATGTGGTCCTTATTCTCGAGAATAAGGACCACATAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-2553s1c1
Sequence:CCGGGCTCATTGGAAAGGTCAGAATCTCGAGATTCTGACCTTTCCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004416.1-4250s1c1
Sequence:CCGGCCTCGGTTCTTAACTCTTCAACTCGAGTTGAAGAGTTAAGAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-4098s1c1
Sequence:CCGGCCAGTCCAACAACTTCAGCTACTCGAGTAGCTGAAGTTGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004416.1-2853s1c1
Sequence:CCGGCGACACCTTCATACAGGATTACTCGAGTAATCCTGTATGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks