EMAIL THIS PAGE TO A FRIEND

UMPS

uridine monophosphate synthetase

Synonyms: OPRT
Gene ID:
Human(7372) Summary: This gene encodes a uridine 5'-monophosphate synthase. The encoded protein is a bifunctional enzyme that catalyzes the final two steps of the de novo pyrimidine biosynthetic pathway. The first reaction is carried out by the N-terminal enzyme orotate phosphoribosyltransferase which converts orotic acid to orotidine-5'-monophosphate. The terminal reaction is carried out by the C-terminal enzyme OMP decarboxylase which converts orotidine-5'-monophosphate to uridine monophosphate. Defects in this gene are the cause of hereditary orotic aciduria. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(22247) uridine monophosphate synthetase
Rat(288051) uridine monophosphate synthetase
cow(281568) uridine monophosphate synthetase
sheep(780512) uridine monophosphate synthetase
sheep(101116528) uridine monophosphate synthetase
naked mole-rat(101699019) uridine monophosphate synthetase
Domestic Rabbit(100353794) uridine monophosphate synthetase
domestic guinea pig(100726089) uridine monophosphate synthetase
Zebrafish(393143) uridine monophosphate synthetase
Horse(100070386) uridine monophosphate synthetase
domestic cat(101095364) uridine monophosphate synthetase
dog(478593) uridine monophosphate synthetase
chicken(424256) uridine monophosphate synthetase
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000373 Rosetta Predictions human pricing
NM_001025402 Rosetta Predictions rat pricing
NM_009471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213543 predicted 990
2 SASI_Hs01_00213544 predicted 427
3 SASI_Hs01_00213545 predicted 367
4 SASI_Hs01_00213547 predicted 913
5 SASI_Hs02_00302427 predicted 501
6 SASI_Hs02_00302428 predicted 324
7 SASI_Hs01_00213550 predicted 817
8 SASI_Hs01_00213551 predicted 408
9 SASI_Hs02_00302429 predicted 474
10 SASI_Hs02_00302430 predicted 1321
11 SASI_Hs01_00213546 predicted 1592
12 SASI_Hs01_00213548 predicted 1403
13 SASI_Hs01_00213549 predicted 329
14 SASI_Hs01_00213552 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067781 predicted 248
2 SASI_Rn01_00067782 predicted 935
3 SASI_Rn01_00067783 predicted 755
4 SASI_Rn01_00067784 predicted 1208
5 SASI_Rn01_00067786 predicted 310
6 SASI_Rn02_00203135 predicted 1181
7 SASI_Rn01_00067787 predicted 286
8 SASI_Rn01_00067788 predicted 585
9 SASI_Rn01_00067789 predicted 232
10 SASI_Rn01_00067790 predicted 262
11 SASI_Rn01_00067785 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039851 predicted 953
2 SASI_Mm01_00039852 predicted 315
3 SASI_Mm01_00039853 predicted 603
4 SASI_Mm01_00039855 predicted 688
5 SASI_Mm01_00039856 predicted 249
6 SASI_Mm01_00039857 predicted 1198
7 SASI_Mm01_00039858 predicted 1236
8 SASI_Mm01_00039859 predicted 952
9 SASI_Mm01_00039860 predicted 324
10 SASI_Mm02_00316197 predicted 314
11 SASI_Mm01_00039854 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000373
VALIDATED
UMPS MISSION shRNA Bacterial Glycerol Stock
uridine monophosphate synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-913s1c1
Sequence:CCGGCAGATGCTTTAGGACCTAGTACTCGAGTACTAGGTCCTAAAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000373.1-1518s1c1
Sequence:CCGGGAAGCGTATTTGAGTAGACTTCTCGAGAAGTCTACTCAAATACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000373.1-1395s1c1
Sequence:CCGGCAGTACAATAGCCCACAAGAACTCGAGTTCTTGTGGGCTATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-423s1c1
Sequence:CCGGCGTCTTGTAGAAGGAACTATTCTCGAGAATAGTTCCTTCTACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-326s1c1
Sequence:CCGGGCCTTATACAGCTTTGCCATTCTCGAGAATGGCAAAGCTGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-915s21c1
Sequence:CCGGCAGATGCTTTAGGACCTAGTACTCGAGTACTAGGTCCTAAAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000373.2-328s21c1
Sequence:CCGGGCCTTATACAGCTTTGCCATTCTCGAGAATGGCAAAGCTGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-425s21c1
Sequence:CCGGCGTCTTGTAGAAGGAACTATTCTCGAGAATAGTTCCTTCTACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-1397s21c1
Sequence:CCGGCAGTACAATAGCCCACAAGAACTCGAGTTCTTGTGGGCTATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000373
VALIDATED
UMPS MISSION shRNA shRNA Plasmid DNA
uridine monophosphate synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-913s1c1
Sequence:CCGGCAGATGCTTTAGGACCTAGTACTCGAGTACTAGGTCCTAAAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000373.1-1518s1c1
Sequence:CCGGGAAGCGTATTTGAGTAGACTTCTCGAGAAGTCTACTCAAATACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000373.1-1395s1c1
Sequence:CCGGCAGTACAATAGCCCACAAGAACTCGAGTTCTTGTGGGCTATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-423s1c1
Sequence:CCGGCGTCTTGTAGAAGGAACTATTCTCGAGAATAGTTCCTTCTACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-326s1c1
Sequence:CCGGGCCTTATACAGCTTTGCCATTCTCGAGAATGGCAAAGCTGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-915s21c1
Sequence:CCGGCAGATGCTTTAGGACCTAGTACTCGAGTACTAGGTCCTAAAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000373.2-328s21c1
Sequence:CCGGGCCTTATACAGCTTTGCCATTCTCGAGAATGGCAAAGCTGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-425s21c1
Sequence:CCGGCGTCTTGTAGAAGGAACTATTCTCGAGAATAGTTCCTTCTACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-1397s21c1
Sequence:CCGGCAGTACAATAGCCCACAAGAACTCGAGTTCTTGTGGGCTATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000373
VALIDATED
UMPS MISSION shRNA Lentiviral Transduction Particles
uridine monophosphate synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-913s1c1
Sequence:CCGGCAGATGCTTTAGGACCTAGTACTCGAGTACTAGGTCCTAAAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000373.1-1518s1c1
Sequence:CCGGGAAGCGTATTTGAGTAGACTTCTCGAGAAGTCTACTCAAATACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000373.1-1395s1c1
Sequence:CCGGCAGTACAATAGCCCACAAGAACTCGAGTTCTTGTGGGCTATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-423s1c1
Sequence:CCGGCGTCTTGTAGAAGGAACTATTCTCGAGAATAGTTCCTTCTACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000373.1-326s1c1
Sequence:CCGGGCCTTATACAGCTTTGCCATTCTCGAGAATGGCAAAGCTGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-915s21c1
Sequence:CCGGCAGATGCTTTAGGACCTAGTACTCGAGTACTAGGTCCTAAAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000373.2-328s21c1
Sequence:CCGGGCCTTATACAGCTTTGCCATTCTCGAGAATGGCAAAGCTGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-425s21c1
Sequence:CCGGCGTCTTGTAGAAGGAACTATTCTCGAGAATAGTTCCTTCTACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000373.2-1397s21c1
Sequence:CCGGCAGTACAATAGCCCACAAGAACTCGAGTTCTTGTGGGCTATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009471
VALIDATED
UMPS MISSION shRNA Bacterial Glycerol Stock
uridine monophosphate synthetase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009471.1-1992s1c1
Sequence:CCGGGCACCCACATTGTGTCTCAAACTCGAGTTTGAGACACAATGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-995s1c1
Sequence:CCGGGCAGTATGAAAGTGGCACCTTCTCGAGAAGGTGCCACTTTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-343s1c1
Sequence:CCGGGCCTTGTAGAAGGAGAGATTACTCGAGTAATCTCTCCTTCTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-1347s1c1
Sequence:CCGGCGCGGTTCTGATGTCATCATTCTCGAGAATGATGACATCAGAACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-672s1c1
Sequence:CCGGCCTGAGAAGAAAGCGTGCAAACTCGAGTTTGCACGCTTTCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009471
VALIDATED
UMPS MISSION shRNA shRNA Plasmid DNA
uridine monophosphate synthetase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009471.1-1992s1c1
Sequence:CCGGGCACCCACATTGTGTCTCAAACTCGAGTTTGAGACACAATGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-995s1c1
Sequence:CCGGGCAGTATGAAAGTGGCACCTTCTCGAGAAGGTGCCACTTTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-343s1c1
Sequence:CCGGGCCTTGTAGAAGGAGAGATTACTCGAGTAATCTCTCCTTCTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-1347s1c1
Sequence:CCGGCGCGGTTCTGATGTCATCATTCTCGAGAATGATGACATCAGAACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-672s1c1
Sequence:CCGGCCTGAGAAGAAAGCGTGCAAACTCGAGTTTGCACGCTTTCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009471
VALIDATED
UMPS MISSION shRNA Lentiviral Transduction Particles
uridine monophosphate synthetase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009471.1-1992s1c1
Sequence:CCGGGCACCCACATTGTGTCTCAAACTCGAGTTTGAGACACAATGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-995s1c1
Sequence:CCGGGCAGTATGAAAGTGGCACCTTCTCGAGAAGGTGCCACTTTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-343s1c1
Sequence:CCGGGCCTTGTAGAAGGAGAGATTACTCGAGTAATCTCTCCTTCTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-1347s1c1
Sequence:CCGGCGCGGTTCTGATGTCATCATTCTCGAGAATGATGACATCAGAACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009471.1-672s1c1
Sequence:CCGGCCTGAGAAGAAAGCGTGCAAACTCGAGTTTGCACGCTTTCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks