EMAIL THIS PAGE TO A FRIEND

UNC119

unc-119 homolog (C. elegans)

Synonyms: HRG4 POC7 POC7A
UniProtKB ID: Q13432, A8K8G4, F1T095, O95126
Gene ID:
Human(9094) Summary: This gene is specifically expressed in the photoreceptors in the retina. The encoded product shares strong homology with the C. elegans unc119 protein and it can functionally complement the C. elegans unc119 mutation. It has been localized to the photoreceptor synapses in the outer plexiform layer of the retina, and suggested to play a role in the mechanism of photoreceptor neurotransmitter release through the synaptic vesicle cycle. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(22248) unc-119 homolog (C. elegans)
Rat(29402) UNC-119 homolog (C. elegans)
chicken(771690) unc-119 homolog (C. elegans)
domestic cat(101099339) unc-119 homolog (C. elegans)
dog(491169) unc-119 homolog (C. elegans)
cow(538501) unc-119 homolog (C. elegans)
sheep(101119999) unc-119 homolog (C. elegans)
domestic guinea pig(100726388) unc-119 homolog (C. elegans)
naked mole-rat(101709556) unc-119 homolog (C. elegans)
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005148 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005148 Rosetta Predictions human pricing
NM_054035 Rosetta Predictions human pricing
NM_017188 Rosetta Predictions rat pricing
NM_011676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024587 predicted 1155
2 SASI_Hs02_00339083 predicted 386
3 SASI_Hs01_00024588 predicted 1070
4 SASI_Hs01_00024590 predicted 1097
5 SASI_Hs01_00024592 predicted 1034
6 SASI_Hs01_00024593 predicted 995
7 SASI_Hs01_00024594 predicted 1147
8 SASI_Hs01_00024595 predicted 1066
9 SASI_Hs02_00339084 predicted 437
10 SASI_Hs01_00024596 predicted 397
11 SASI_Hs01_00024589 predicted 1069
12 SASI_Hs01_00024591 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361979 predicted 391
2 SASI_Hs02_00361980 predicted 439
3 SASI_Hs01_00046189 predicted 391
4 SASI_Hs01_00046190 predicted 332
5 SASI_Hs01_00046191 predicted 802
6 SASI_Hs01_00046192 predicted 524
7 SASI_Hs01_00046193 predicted 628
8 SASI_Hs01_00046188 predicted 1175
9 SASI_Hs01_00046195 predicted 974
10 SASI_Hs01_00046196 predicted 944
11 SASI_Hs01_00046194 predicted 308
12 SASI_Hs01_00046197 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074852 predicted 799
2 SASI_Rn01_00074853 predicted 287
3 SASI_Rn01_00074854 predicted 636
4 SASI_Rn02_00261534 predicted 621
5 SASI_Rn01_00074855 predicted 678
6 SASI_Rn01_00074856 predicted 847
7 SASI_Rn01_00074857 predicted 499
8 SASI_Rn01_00074858 predicted 675
9 SASI_Rn01_00074859 predicted 796
10 SASI_Rn01_00074860 predicted 624
11 SASI_Rn01_00074851 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060360 predicted 303
2 SASI_Mm01_00060362 predicted 522
3 SASI_Mm02_00321206 predicted 418
4 SASI_Mm02_00321207 predicted 415
5 SASI_Mm01_00060366 predicted 502
6 SASI_Mm02_00321208 predicted 497
7 SASI_Mm02_00321209 predicted 442
8 SASI_Mm02_00321210 predicted 514
9 SASI_Mm02_00321211 predicted 245
10 SASI_Mm02_00321212 predicted 386
11 SASI_Mm01_00060361 predicted 810
12 SASI_Mm01_00060363 predicted 800
13 SASI_Mm01_00060364 predicted 668
14 SASI_Mm01_00060365 predicted 656
15 SASI_Mm01_00060367 predicted 686
16 SASI_Mm01_00060368 predicted 741
17 SASI_Mm01_00060369 predicted 678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005148
VALIDATED
UNC119 MISSION shRNA Bacterial Glycerol Stock
unc-119 homolog (C. elegans)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-524s21c1
Sequence:CCGGGGGAGACAAGCCTGTCAACAACTCGAGTTGTTGACAGGCTTGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005148.3-1048s21c1
Sequence:CCGGTCAGGACTTCCGGACAACTTACTCGAGTAAGTTGTCCGGAAGTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-570s21c1
Sequence:CCGGTTCCGCAACCAGCTACTCAAACTCGAGTTTGAGTAGCTGGTTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-632s21c1
Sequence:CCGGGAACACCTGCGAGCACATTTACTCGAGTAAATGTGCTCGCAGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005148.3-1126s21c1
Sequence:CCCGTAGATCAGGCAGGGATCCATTCTCGAGAATGGATCCCTGCCTGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005148.2-911s1c1
Sequence:CCGGCTGAGTCAATGTTGGGAGGAACTCGAGTTCCTCCCAACATTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-590s1c1
Sequence:CCGGCTTCGACTTCCACTTTGGCTTCTCGAGAAGCCAAAGTGGAAGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005148.2-361s1c1
Sequence:CCGGCAGGCACTGTCCTCTTTGAAACTCGAGTTTCAAAGAGGACAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-1083s1c1
Sequence:CCGGCCCAAGTTTCAGAATAGTGTTCTCGAGAACACTATTCTGAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-749s1c1
Sequence:CCGGGATGCACAATAAAGCAGACTACTCGAGTAGTCTGCTTTATTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-323s1c1
Sequence:CCGGGATCGACTTTGTCAGGTTTAACTCGAGTTAAACCTGACAAAGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005148
VALIDATED
UNC119 MISSION shRNA shRNA Plasmid DNA
unc-119 homolog (C. elegans)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-524s21c1
Sequence:CCGGGGGAGACAAGCCTGTCAACAACTCGAGTTGTTGACAGGCTTGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005148.3-1048s21c1
Sequence:CCGGTCAGGACTTCCGGACAACTTACTCGAGTAAGTTGTCCGGAAGTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-570s21c1
Sequence:CCGGTTCCGCAACCAGCTACTCAAACTCGAGTTTGAGTAGCTGGTTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-632s21c1
Sequence:CCGGGAACACCTGCGAGCACATTTACTCGAGTAAATGTGCTCGCAGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005148.3-1126s21c1
Sequence:CCCGTAGATCAGGCAGGGATCCATTCTCGAGAATGGATCCCTGCCTGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005148.2-911s1c1
Sequence:CCGGCTGAGTCAATGTTGGGAGGAACTCGAGTTCCTCCCAACATTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-590s1c1
Sequence:CCGGCTTCGACTTCCACTTTGGCTTCTCGAGAAGCCAAAGTGGAAGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005148.2-361s1c1
Sequence:CCGGCAGGCACTGTCCTCTTTGAAACTCGAGTTTCAAAGAGGACAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-1083s1c1
Sequence:CCGGCCCAAGTTTCAGAATAGTGTTCTCGAGAACACTATTCTGAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-749s1c1
Sequence:CCGGGATGCACAATAAAGCAGACTACTCGAGTAGTCTGCTTTATTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-323s1c1
Sequence:CCGGGATCGACTTTGTCAGGTTTAACTCGAGTTAAACCTGACAAAGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005148
VALIDATED
UNC119 MISSION shRNA Lentiviral Transduction Particles
unc-119 homolog (C. elegans)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-524s21c1
Sequence:CCGGGGGAGACAAGCCTGTCAACAACTCGAGTTGTTGACAGGCTTGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005148.3-1048s21c1
Sequence:CCGGTCAGGACTTCCGGACAACTTACTCGAGTAAGTTGTCCGGAAGTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-570s21c1
Sequence:CCGGTTCCGCAACCAGCTACTCAAACTCGAGTTTGAGTAGCTGGTTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005148.3-632s21c1
Sequence:CCGGGAACACCTGCGAGCACATTTACTCGAGTAAATGTGCTCGCAGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005148.3-1126s21c1
Sequence:CCCGTAGATCAGGCAGGGATCCATTCTCGAGAATGGATCCCTGCCTGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005148.2-911s1c1
Sequence:CCGGCTGAGTCAATGTTGGGAGGAACTCGAGTTCCTCCCAACATTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-590s1c1
Sequence:CCGGCTTCGACTTCCACTTTGGCTTCTCGAGAAGCCAAAGTGGAAGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005148.2-361s1c1
Sequence:CCGGCAGGCACTGTCCTCTTTGAAACTCGAGTTTCAAAGAGGACAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-1083s1c1
Sequence:CCGGCCCAAGTTTCAGAATAGTGTTCTCGAGAACACTATTCTGAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-749s1c1
Sequence:CCGGGATGCACAATAAAGCAGACTACTCGAGTAGTCTGCTTTATTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005148.2-323s1c1
Sequence:CCGGGATCGACTTTGTCAGGTTTAACTCGAGTTAAACCTGACAAAGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011676
VALIDATED
UNC119 MISSION shRNA Bacterial Glycerol Stock
unc-119 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-661s21c1
Sequence:CCGGGAGATGATTCGTCACCCGTATCTCGAGATACGGGTGACGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-649s21c1
Sequence:CCGGGAGCTAATCAGTGAGATGATTCTCGAGAATCATCTCACTGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-300s21c1
Sequence:CCGGGATTGACTTCGTCAGGTTCAACTCGAGTTGAACCTGACGAAGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-726s21c1
Sequence:CCGGGATGCATAACAAAGCAGACTACTCGAGTAGTCTGCTTTGTTATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-661s1c1
Sequence:CCGGGAGATGATTCGTCACCCGTATCTCGAGATACGGGTGACGAATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-300s1c1
Sequence:CCGGGATTGACTTCGTCAGGTTCAACTCGAGTTGAACCTGACGAAGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-649s1c1
Sequence:CCGGGAGCTAATCAGTGAGATGATTCTCGAGAATCATCTCACTGATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011676.2-726s1c1
Sequence:CCGGGATGCATAACAAAGCAGACTACTCGAGTAGTCTGCTTTGTTATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011676.2-645s1c1
Sequence:CCGGCGAGGAGCTAATCAGTGAGATCTCGAGATCTCACTGATTAGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011676.2-740s1c1
Sequence:CCGGCAGACTATTCCTACAGTGGGACTCGAGTCCCACTGTAGGAATAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011676
VALIDATED
UNC119 MISSION shRNA shRNA Plasmid DNA
unc-119 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-661s21c1
Sequence:CCGGGAGATGATTCGTCACCCGTATCTCGAGATACGGGTGACGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-649s21c1
Sequence:CCGGGAGCTAATCAGTGAGATGATTCTCGAGAATCATCTCACTGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-300s21c1
Sequence:CCGGGATTGACTTCGTCAGGTTCAACTCGAGTTGAACCTGACGAAGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-726s21c1
Sequence:CCGGGATGCATAACAAAGCAGACTACTCGAGTAGTCTGCTTTGTTATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-661s1c1
Sequence:CCGGGAGATGATTCGTCACCCGTATCTCGAGATACGGGTGACGAATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-300s1c1
Sequence:CCGGGATTGACTTCGTCAGGTTCAACTCGAGTTGAACCTGACGAAGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-649s1c1
Sequence:CCGGGAGCTAATCAGTGAGATGATTCTCGAGAATCATCTCACTGATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011676.2-726s1c1
Sequence:CCGGGATGCATAACAAAGCAGACTACTCGAGTAGTCTGCTTTGTTATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011676.2-645s1c1
Sequence:CCGGCGAGGAGCTAATCAGTGAGATCTCGAGATCTCACTGATTAGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011676.2-740s1c1
Sequence:CCGGCAGACTATTCCTACAGTGGGACTCGAGTCCCACTGTAGGAATAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011676
VALIDATED
UNC119 MISSION shRNA Lentiviral Transduction Particles
unc-119 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-661s21c1
Sequence:CCGGGAGATGATTCGTCACCCGTATCTCGAGATACGGGTGACGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-649s21c1
Sequence:CCGGGAGCTAATCAGTGAGATGATTCTCGAGAATCATCTCACTGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-300s21c1
Sequence:CCGGGATTGACTTCGTCAGGTTCAACTCGAGTTGAACCTGACGAAGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011676.2-726s21c1
Sequence:CCGGGATGCATAACAAAGCAGACTACTCGAGTAGTCTGCTTTGTTATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-661s1c1
Sequence:CCGGGAGATGATTCGTCACCCGTATCTCGAGATACGGGTGACGAATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-300s1c1
Sequence:CCGGGATTGACTTCGTCAGGTTCAACTCGAGTTGAACCTGACGAAGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011676.2-649s1c1
Sequence:CCGGGAGCTAATCAGTGAGATGATTCTCGAGAATCATCTCACTGATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011676.2-726s1c1
Sequence:CCGGGATGCATAACAAAGCAGACTACTCGAGTAGTCTGCTTTGTTATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011676.2-645s1c1
Sequence:CCGGCGAGGAGCTAATCAGTGAGATCTCGAGATCTCACTGATTAGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011676.2-740s1c1
Sequence:CCGGCAGACTATTCCTACAGTGGGACTCGAGTCCCACTGTAGGAATAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks