EMAIL THIS PAGE TO A FRIEND

UNC119B

unc-119 homolog B (C. elegans)

Synonyms: POC7B
UniProtKB ID: A6NIH7
Gene ID:
Mouse(106840) unc-119 homolog B (C. elegans)
Rat(288702) unc-119 homolog B (C. elegans)
Zebrafish(678653) unc-119 homolog b (C. elegans)
chicken(416970) unc-119 homolog B (C. elegans)
dog(611530) unc-119 homolog B (C. elegans)
domestic cat(101097675) unc-119 homolog B (C. elegans)
naked mole-rat(101722639) unc-119 homolog B (C. elegans)
domestic guinea pig(100735144) unc-119 homolog B (C. elegans)
cow(617896) unc-119 homolog B (C. elegans)
sheep(101113013) unc-119 homolog B (C. elegans)
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302279 ANTI-U119B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080533 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080533 Rosetta Predictions human pricing
XM_930036 Rosetta Predictions human pricing
XM_934229 Rosetta Predictions human pricing
NM_001105934 Rosetta Predictions rat pricing
NM_175352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315767 predicted 1260
2 SASI_Hs02_00315768 predicted 1065
3 SASI_Hs02_00315769 predicted 722
4 SASI_Hs02_00315770 predicted 1422
5 SASI_Hs02_00315771 predicted 940
6 SASI_Hs02_00315772 predicted 1034
7 SASI_Hs02_00315773 predicted 681
8 SASI_Hs02_00315774 predicted 925
9 SASI_Hs02_00315775 predicted 1323
10 SASI_Hs02_00315776 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297852 predicted 1265
2 SASI_Hs01_00297853 predicted 1069
3 SASI_Hs01_00297854 predicted 717
4 SASI_Hs01_00297855 predicted 1423
5 SASI_Hs01_00297856 predicted 936
6 SASI_Hs01_00297857 predicted 1040
7 SASI_Hs01_00297858 predicted 684
8 SASI_Hs01_00297859 predicted 1688
9 SASI_Hs01_00297860 predicted 924
10 SASI_Hs01_00297861 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266974 predicted 1083
2 SASI_Hs01_00266975 predicted 1266
3 SASI_Hs01_00266976 predicted 1063
4 SASI_Hs01_00266977 predicted 714
5 SASI_Hs01_00266978 predicted 1418
6 SASI_Hs01_00266979 predicted 940
7 SASI_Hs01_00266980 predicted 1036
8 SASI_Hs01_00266981 predicted 686
9 SASI_Hs01_00266982 predicted 1687
10 SASI_Hs01_00266983 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213982 predicted 472
2 SASI_Rn02_00213983 predicted 323
3 SASI_Rn02_00213984 predicted 1006
4 SASI_Rn02_00213985 predicted 1115
5 SASI_Rn02_00213986 predicted 1032
6 SASI_Rn02_00213987 predicted 264
7 SASI_Rn02_00213988 predicted 569
8 SASI_Rn02_00213989 predicted 692
9 SASI_Rn02_00213990 predicted 809
10 SASI_Rn02_00213991 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057217 predicted 302
2 SASI_Mm01_00057218 predicted 1076
3 SASI_Mm01_00057219 predicted 1042
4 SASI_Mm01_00057220 predicted 467
5 SASI_Mm01_00057221 predicted 606
6 SASI_Mm01_00057222 predicted 1280
7 SASI_Mm01_00057223 predicted 794
8 SASI_Mm01_00057224 predicted 378
9 SASI_Mm01_00057225 predicted 559
10 SASI_Mm01_00057226 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175352
VALIDATED
UNC119B MISSION shRNA Bacterial Glycerol Stock
unc-119 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175352.2-3461s1c1
Sequence:CCGGCGTGAGGGATAATGGCCTTTACTCGAGTAAAGGCCATTATCCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-478s1c1
Sequence:CCGGCCGTTTCGTTCGATATCAGTTCTCGAGAACTGATATCGAACGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-754s1c1
Sequence:CCGGCTTCTACTTTGTTGACAACAACTCGAGTTGTTGTCAACAAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-753s1c1
Sequence:CCGGGCTTCTACTTTGTTGACAACACTCGAGTGTTGTCAACAAAGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-317s1c1
Sequence:CCGGCTGTGTAAACCTGAAGACAATCTCGAGATTGTCTTCAGGTTTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175352
VALIDATED
UNC119B MISSION shRNA shRNA Plasmid DNA
unc-119 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175352.2-3461s1c1
Sequence:CCGGCGTGAGGGATAATGGCCTTTACTCGAGTAAAGGCCATTATCCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-478s1c1
Sequence:CCGGCCGTTTCGTTCGATATCAGTTCTCGAGAACTGATATCGAACGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-754s1c1
Sequence:CCGGCTTCTACTTTGTTGACAACAACTCGAGTTGTTGTCAACAAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-753s1c1
Sequence:CCGGGCTTCTACTTTGTTGACAACACTCGAGTGTTGTCAACAAAGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-317s1c1
Sequence:CCGGCTGTGTAAACCTGAAGACAATCTCGAGATTGTCTTCAGGTTTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175352
VALIDATED
UNC119B MISSION shRNA Lentiviral Transduction Particles
unc-119 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175352.2-3461s1c1
Sequence:CCGGCGTGAGGGATAATGGCCTTTACTCGAGTAAAGGCCATTATCCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-478s1c1
Sequence:CCGGCCGTTTCGTTCGATATCAGTTCTCGAGAACTGATATCGAACGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-754s1c1
Sequence:CCGGCTTCTACTTTGTTGACAACAACTCGAGTTGTTGTCAACAAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-753s1c1
Sequence:CCGGGCTTCTACTTTGTTGACAACACTCGAGTGTTGTCAACAAAGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175352.2-317s1c1
Sequence:CCGGCTGTGTAAACCTGAAGACAATCTCGAGATTGTCTTCAGGTTTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080533
VALIDATED
UNC119B MISSION shRNA Bacterial Glycerol Stock
unc-119 homolog B (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-1415s21c1
Sequence:CCGGGTAGGTTGCAGAGGTACTATACTCGAGTATAGTACCTCTGCAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080533.1-678s21c1
Sequence:CCGGCCGGGTCACCGAGAATTATTTCTCGAGAAATAATTCTCGGTGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-1080s21c1
Sequence:CCGGGGAGGATGTCATTCGTCTAATCTCGAGATTAGACGAATGACATCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-961s21c1
Sequence:CCGGATGATCGAACGGCACTATTTCCTCGAGGAAATAGTGCCGTTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-871s21c1
Sequence:CCGGTATCAGTTCACACCGGCATTTCTCGAGAAATGCCGGTGTGAACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080533
VALIDATED
UNC119B MISSION shRNA shRNA Plasmid DNA
unc-119 homolog B (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-1415s21c1
Sequence:CCGGGTAGGTTGCAGAGGTACTATACTCGAGTATAGTACCTCTGCAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080533.1-678s21c1
Sequence:CCGGCCGGGTCACCGAGAATTATTTCTCGAGAAATAATTCTCGGTGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-1080s21c1
Sequence:CCGGGGAGGATGTCATTCGTCTAATCTCGAGATTAGACGAATGACATCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-961s21c1
Sequence:CCGGATGATCGAACGGCACTATTTCCTCGAGGAAATAGTGCCGTTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-871s21c1
Sequence:CCGGTATCAGTTCACACCGGCATTTCTCGAGAAATGCCGGTGTGAACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080533
VALIDATED
UNC119B MISSION shRNA Lentiviral Transduction Particles
unc-119 homolog B (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-1415s21c1
Sequence:CCGGGTAGGTTGCAGAGGTACTATACTCGAGTATAGTACCTCTGCAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080533.1-678s21c1
Sequence:CCGGCCGGGTCACCGAGAATTATTTCTCGAGAAATAATTCTCGGTGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-1080s21c1
Sequence:CCGGGGAGGATGTCATTCGTCTAATCTCGAGATTAGACGAATGACATCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-961s21c1
Sequence:CCGGATGATCGAACGGCACTATTTCCTCGAGGAAATAGTGCCGTTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080533.1-871s21c1
Sequence:CCGGTATCAGTTCACACCGGCATTTCTCGAGAAATGCCGGTGTGAACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks