EMAIL THIS PAGE TO A FRIEND

UNC13A

unc-13 homolog A (C. elegans)

Synonyms: Munc13-1
UniProtKB ID: Q9UPW8, E5RHY9
Gene ID:
Human(23025) Summary: This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
Mouse(382018) unc-13 homolog A (C. elegans)
Rat(64829) unc-13 homolog A (C. elegans)
domestic guinea pig(100735528) unc-13 homolog A (C. elegans)
naked mole-rat(101710593) unc-13 homolog A (C. elegans)
cow(526874) unc-13 homolog A (C. elegans)
sheep(101113588) unc-13 homolog A (C. elegans)
dog(484833) unc-13 homolog A (C. elegans)
domestic cat(101091602) unc-13 homolog A (C. elegans)
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080421 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_356087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080421 Rosetta Predictions human pricing
XM_038604 Rosetta Predictions human pricing
NM_022861 Rosetta Predictions rat pricing
NM_001029873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314686 predicted 2022
2 SASI_Hs02_00314687 predicted 931
3 SASI_Hs02_00314688 predicted 4193
4 SASI_Hs02_00314689 predicted 896
5 SASI_Hs02_00314690 predicted 3262
6 SASI_Hs02_00314691 predicted 4031
7 SASI_Hs02_00314692 predicted 3089
8 SASI_Hs02_00314693 predicted 2167
9 SASI_Hs02_00314694 predicted 3381
10 SASI_Hs02_00314695 predicted 4079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_038604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295592 predicted 1759
2 SASI_Hs01_00295593 predicted 676
3 SASI_Hs01_00295594 predicted 3935
4 SASI_Hs01_00295595 predicted 2270
5 SASI_Hs01_00295596 predicted 640
6 SASI_Hs01_00295597 predicted 3013
7 SASI_Hs01_00295598 predicted 3769
8 SASI_Hs01_00295599 predicted 2835
9 SASI_Hs01_00295600 predicted 1902
10 SASI_Hs01_00295601 predicted 3121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082055 predicted 4259
2 SASI_Rn01_00082056 predicted 3353
3 SASI_Rn01_00082057 predicted 3393
4 SASI_Rn01_00082058 predicted 3385
5 SASI_Rn01_00082059 predicted 3420
6 SASI_Rn01_00082060 predicted 3280
7 SASI_Rn02_00263592 predicted 3152
8 SASI_Rn01_00082061 predicted 1566
9 SASI_Rn01_00082062 predicted 3977
10 SASI_Rn01_00082063 predicted 5806
11 SASI_Rn01_00082064 predicted 3485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079135 predicted 4033
2 SASI_Mm01_00079136 predicted 645
3 SASI_Mm01_00079137 predicted 3475
4 SASI_Mm01_00079138 predicted 953
5 SASI_Mm01_00079139 predicted 2629
6 SASI_Mm02_00288044 predicted 2367
7 SASI_Mm01_00079140 predicted 614
8 SASI_Mm01_00079141 predicted 4285
9 SASI_Mm01_00079142 predicted 4976
10 SASI_Mm01_00079144 predicted 2261
11 SASI_Mm01_00079143 predicted 3513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029873
UNC13A MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-945s21c1
Sequence:GTACCGGCATCCTCCTGGACGCTCATTTCTCGAGAAATGAGCGTCCAGGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-2565s21c1
Sequence:GTACCGGCCGGATCAAGGTTCGTGTTTGCTCGAGCAAACACGAACCTTGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-611s21c1
Sequence:GTACCGGCAACTCTGGGTGCCTACAATACTCGAGTATTGTAGGCACCCAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-3511s21c1
Sequence:GTACCGGATCACCCTCATCGTGTCTATCCTCGAGGATAGACACGATGAGGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-3611s21c1
Sequence:GTACCGGAGGTGATGTGGAGCCTATTTGCTCGAGCAAATAGGCTCCACATCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029873
UNC13A MISSION shRNA shRNA Plasmid DNA
unc-13 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-945s21c1
Sequence:GTACCGGCATCCTCCTGGACGCTCATTTCTCGAGAAATGAGCGTCCAGGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-2565s21c1
Sequence:GTACCGGCCGGATCAAGGTTCGTGTTTGCTCGAGCAAACACGAACCTTGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-611s21c1
Sequence:GTACCGGCAACTCTGGGTGCCTACAATACTCGAGTATTGTAGGCACCCAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-3511s21c1
Sequence:GTACCGGATCACCCTCATCGTGTCTATCCTCGAGGATAGACACGATGAGGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-3611s21c1
Sequence:GTACCGGAGGTGATGTGGAGCCTATTTGCTCGAGCAAATAGGCTCCACATCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029873
UNC13A MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-945s21c1
Sequence:GTACCGGCATCCTCCTGGACGCTCATTTCTCGAGAAATGAGCGTCCAGGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-2565s21c1
Sequence:GTACCGGCCGGATCAAGGTTCGTGTTTGCTCGAGCAAACACGAACCTTGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-611s21c1
Sequence:GTACCGGCAACTCTGGGTGCCTACAATACTCGAGTATTGTAGGCACCCAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-3511s21c1
Sequence:GTACCGGATCACCCTCATCGTGTCTATCCTCGAGGATAGACACGATGAGGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029873.1-3611s21c1
Sequence:GTACCGGAGGTGATGTGGAGCCTATTTGCTCGAGCAAATAGGCTCCACATCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080421
UNC13A MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog A (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080421.1-8902s21c1
Sequence:CCGGGAACCCTGGACCTCGCTTTATCTCGAGATAAAGCGAGGTCCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-714s21c1
Sequence:CCGGTATGCGGGACCAGGATGAATACTCGAGTATTCATCCTGGTCCCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-923s21c1
Sequence:CCGGACGCCTCAGTCCACCAATATTCTCGAGAATATTGGTGGACTGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-3567s21c1
Sequence:CCGGGCACGACAAGCATCGTCTATGCTCGAGCATAGACGATGCTTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-5000s21c1
Sequence:CCGGGCGACAAGAAACGCAAGTTTGCTCGAGCAAACTTGCGTTTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080421
UNC13A MISSION shRNA shRNA Plasmid DNA
unc-13 homolog A (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080421.1-8902s21c1
Sequence:CCGGGAACCCTGGACCTCGCTTTATCTCGAGATAAAGCGAGGTCCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-714s21c1
Sequence:CCGGTATGCGGGACCAGGATGAATACTCGAGTATTCATCCTGGTCCCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-923s21c1
Sequence:CCGGACGCCTCAGTCCACCAATATTCTCGAGAATATTGGTGGACTGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-3567s21c1
Sequence:CCGGGCACGACAAGCATCGTCTATGCTCGAGCATAGACGATGCTTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-5000s21c1
Sequence:CCGGGCGACAAGAAACGCAAGTTTGCTCGAGCAAACTTGCGTTTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080421
UNC13A MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog A (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080421.1-8902s21c1
Sequence:CCGGGAACCCTGGACCTCGCTTTATCTCGAGATAAAGCGAGGTCCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-714s21c1
Sequence:CCGGTATGCGGGACCAGGATGAATACTCGAGTATTCATCCTGGTCCCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-923s21c1
Sequence:CCGGACGCCTCAGTCCACCAATATTCTCGAGAATATTGGTGGACTGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-3567s21c1
Sequence:CCGGGCACGACAAGCATCGTCTATGCTCGAGCATAGACGATGCTTGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080421.1-5000s21c1
Sequence:CCGGGCGACAAGAAACGCAAGTTTGCTCGAGCAAACTTGCGTTTCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356087
UNC13A MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-3019s1c1
Sequence:CCGGCCTAGCATCAAGAACCTGGATCTCGAGATCCAGGTTCTTGATGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-48s1c1
Sequence:CCGGCCAAGAGAAGTTCAACACATACTCGAGTATGTGTTGAACTTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-2153s1c1
Sequence:CCGGCCCGTGTGAAACAAAGGTTTACTCGAGTAAACCTTTGTTTCACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-2671s1c1
Sequence:CCGGGCTGCCTCTAATTTCGGGAAACTCGAGTTTCCCGAAATTAGAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-1815s1c1
Sequence:CCGGGCCTGAGATCTTCGAGCTTATCTCGAGATAAGCTCGAAGATCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356087
UNC13A MISSION shRNA shRNA Plasmid DNA
unc-13 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-3019s1c1
Sequence:CCGGCCTAGCATCAAGAACCTGGATCTCGAGATCCAGGTTCTTGATGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-48s1c1
Sequence:CCGGCCAAGAGAAGTTCAACACATACTCGAGTATGTGTTGAACTTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-2153s1c1
Sequence:CCGGCCCGTGTGAAACAAAGGTTTACTCGAGTAAACCTTTGTTTCACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-2671s1c1
Sequence:CCGGGCTGCCTCTAATTTCGGGAAACTCGAGTTTCCCGAAATTAGAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-1815s1c1
Sequence:CCGGGCCTGAGATCTTCGAGCTTATCTCGAGATAAGCTCGAAGATCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356087
UNC13A MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-3019s1c1
Sequence:CCGGCCTAGCATCAAGAACCTGGATCTCGAGATCCAGGTTCTTGATGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-48s1c1
Sequence:CCGGCCAAGAGAAGTTCAACACATACTCGAGTATGTGTTGAACTTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-2153s1c1
Sequence:CCGGCCCGTGTGAAACAAAGGTTTACTCGAGTAAACCTTTGTTTCACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-2671s1c1
Sequence:CCGGGCTGCCTCTAATTTCGGGAAACTCGAGTTTCCCGAAATTAGAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356087.1-1815s1c1
Sequence:CCGGGCCTGAGATCTTCGAGCTTATCTCGAGATAAGCTCGAAGATCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks