EMAIL THIS PAGE TO A FRIEND

UNC13B

unc-13 homolog B (C. elegans)

Synonyms: MUNC13 UNC13 Unc13h2
UniProtKB ID: O14795, Q5VYM8
Gene ID:
Human(10497) Summary: This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
Mouse(22249) unc-13 homolog B (C. elegans)
Rat(64830) unc-13 homolog B (C. elegans)
dog(100683511) unc-13 homolog B (C. elegans)
Horse(100055666) unc-13 homolog B (C. elegans)
domestic cat(101089655) unc-13 homolog B (C. elegans)
cow(530692) unc-13 homolog B (C. elegans)
sheep(101117731) unc-13 homolog B (C. elegans)
naked mole-rat(101717680) unc-13 homolog B (C. elegans)
Domestic Rabbit(100345810) unc-13 homolog B (C. elegans)
domestic guinea pig(100726943) unc-13 homolog B (C. elegans)
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006377 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100941 MISSION® esiRNA esiRNA human UNC13B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006377 Rosetta Predictions human pricing
NM_001042579 Rosetta Predictions rat pricing
NM_022862 Rosetta Predictions rat pricing
NM_001081413 Rosetta Predictions mouse pricing
XM_984314 Rosetta Predictions mouse pricing
XM_984358 Rosetta Predictions mouse pricing
XM_984396 Rosetta Predictions mouse pricing
XM_984424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341436 predicted 3075
2 SASI_Hs01_00091525 predicted 2666
3 SASI_Hs01_00091527 predicted 539
4 SASI_Hs02_00341437 predicted 2322
5 SASI_Hs01_00091529 predicted 3358
6 SASI_Hs02_00341438 predicted 323
7 SASI_Hs01_00091530 predicted 1939
8 SASI_Hs01_00091531 predicted 2268
9 SASI_Hs01_00091532 predicted 2256
10 SASI_Hs02_00341439 predicted 1379
11 SASI_Hs01_00091526 predicted 2592
12 SASI_Hs01_00091528 predicted 4745
13 SASI_Hs01_00091533 predicted 3905
14 SASI_Hs01_00091534 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204940 predicted 3046
2 SASI_Rn02_00204941 predicted 2098
3 SASI_Rn02_00204942 predicted 2363
4 SASI_Rn02_00204943 predicted 4292
5 SASI_Rn02_00204944 predicted 4605
6 SASI_Rn02_00204945 predicted 4551
7 SASI_Rn02_00204946 predicted 1817
8 SASI_Rn02_00204947 predicted 3042
9 SASI_Rn02_00204948 predicted 3570
10 SASI_Rn02_00204949 predicted 1999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033531 predicted 4524
2 SASI_Rn01_00033532 predicted 3572
3 SASI_Rn01_00033534 predicted 6077
4 SASI_Rn01_00033535 predicted 2252
5 SASI_Rn01_00033536 predicted 6030
6 SASI_Rn01_00033537 predicted 3288
7 SASI_Rn01_00033538 predicted 4520
8 SASI_Rn01_00033539 predicted 5046
9 SASI_Rn02_00263593 predicted 3471
10 SASI_Rn02_00263594 predicted 3718
11 SASI_Rn01_00033533 predicted 3844
12 SASI_Rn01_00033540 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298141 predicted 2915
2 SASI_Mm02_00298142 predicted 3752
3 SASI_Mm02_00298143 predicted 2274
4 SASI_Mm02_00298144 predicted 524
5 SASI_Mm02_00298145 predicted 2731
6 SASI_Mm02_00298146 predicted 1036
7 SASI_Mm02_00298147 predicted 5164
8 SASI_Mm02_00298148 predicted 3440
9 SASI_Mm02_00298149 predicted 2799
10 SASI_Mm02_00298150 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225845 predicted 3683
2 SASI_Mm01_00225846 predicted 3733
3 SASI_Mm01_00225847 predicted 3718
4 SASI_Mm01_00225848 predicted 3734
5 SASI_Mm01_00225849 predicted 605
6 SASI_Mm01_00225850 predicted 3758
7 SASI_Mm01_00225851 predicted 1399
8 SASI_Mm01_00225852 predicted 1382
9 SASI_Mm01_00225853 predicted 3742
10 SASI_Mm01_00225854 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263462 predicted 3688
2 SASI_Mm01_00263463 predicted 3728
3 SASI_Mm01_00263464 predicted 3711
4 SASI_Mm01_00263465 predicted 3751
5 SASI_Mm01_00263466 predicted 598
6 SASI_Mm01_00263467 predicted 3790
7 SASI_Mm01_00263468 predicted 1278
8 SASI_Mm01_00263469 predicted 570
9 SASI_Mm01_00263470 predicted 1294
10 SASI_Mm01_00263471 predicted 3790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205787 predicted 3715
2 SASI_Mm01_00205788 predicted 3764
3 SASI_Mm01_00205789 predicted 3742
4 SASI_Mm01_00205790 predicted 3770
5 SASI_Mm01_00205791 predicted 3788
6 SASI_Mm01_00205792 predicted 1436
7 SASI_Mm01_00205793 predicted 1416
8 SASI_Mm01_00205794 predicted 3765
9 SASI_Mm01_00205795 predicted 1318
10 SASI_Mm01_00205796 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280564 predicted 3681
2 SASI_Mm01_00280565 predicted 3729
3 SASI_Mm01_00280566 predicted 3707
4 SASI_Mm01_00280567 predicted 3735
5 SASI_Mm01_00280568 predicted 607
6 SASI_Mm01_00280569 predicted 3754
7 SASI_Mm01_00280570 predicted 1402
8 SASI_Mm01_00280571 predicted 1376
9 SASI_Mm01_00280572 predicted 3731
10 SASI_Mm01_00280573 predicted 1275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006377
VALIDATED
UNC13B MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog B (C. elegans)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006377.x-2838s1c1
Sequence:CCGGCTCTCTACATACAGGAATAATCTCGAGATTATTCCTGTATGTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-5245s1c1
Sequence:CCGGCCATTAAGAGAGAAGGACAAACTCGAGTTTGTCCTTCTCTCTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-4739s1c1
Sequence:CCGGCGAGTCCTATGAGTTGCAGATCTCGAGATCTGCAACTCATAGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-647s1c1
Sequence:CCGGGACCTACAAATGGGAGCAAATCTCGAGATTTGCTCCCATTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006377.x-1850s1c1
Sequence:CCGGCCGGACCCAGAACATTATCATCTCGAGATGATAATGTTCTGGGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-3982s21c1
Sequence:GTACCGGTGATGAGTGTGTTCGACAAATCTCGAGATTTGTCGAACACACTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-586s21c1
Sequence:CCGGATTAGAGGCAGAGACGTTAATCTCGAGATTAACGTCTCTGCCTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006377.3-5313s21c1
Sequence:CCGGCCATTAAGAGAGAAGGACAAACTCGAGTTTGTCCTTCTCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-3100s21c1
Sequence:GTACCGGCAACAACTGCCACGACTTATACTCGAGTATAAGTCGTGGCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-1957s21c1
Sequence:CCGGGAAGATCCGAGAGCGAAATAACTCGAGTTATTTCGCTCTCGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-1918s21c1
Sequence:CCGGCCGGACCCAGAACATTATCATCTCGAGATGATAATGTTCTGGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-2906s21c1
Sequence:CCGGCTCTCTACATACAGGAATAATCTCGAGATTATTCCTGTATGTAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006377.3-5138s21c1
Sequence:GTACCGGGTAACCGGCTTAGGGTCTTTGCTCGAGCAAAGACCCTAAGCCGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-2272s21c1
Sequence:GTACCGGCCGCATTAAGGTGCGTGTATGCTCGAGCATACACGCACCTTAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006377
VALIDATED
UNC13B MISSION shRNA shRNA Plasmid DNA
unc-13 homolog B (C. elegans)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006377.x-2838s1c1
Sequence:CCGGCTCTCTACATACAGGAATAATCTCGAGATTATTCCTGTATGTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-5245s1c1
Sequence:CCGGCCATTAAGAGAGAAGGACAAACTCGAGTTTGTCCTTCTCTCTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-4739s1c1
Sequence:CCGGCGAGTCCTATGAGTTGCAGATCTCGAGATCTGCAACTCATAGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-647s1c1
Sequence:CCGGGACCTACAAATGGGAGCAAATCTCGAGATTTGCTCCCATTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006377.x-1850s1c1
Sequence:CCGGCCGGACCCAGAACATTATCATCTCGAGATGATAATGTTCTGGGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-3982s21c1
Sequence:GTACCGGTGATGAGTGTGTTCGACAAATCTCGAGATTTGTCGAACACACTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-586s21c1
Sequence:CCGGATTAGAGGCAGAGACGTTAATCTCGAGATTAACGTCTCTGCCTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006377.3-5313s21c1
Sequence:CCGGCCATTAAGAGAGAAGGACAAACTCGAGTTTGTCCTTCTCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-3100s21c1
Sequence:GTACCGGCAACAACTGCCACGACTTATACTCGAGTATAAGTCGTGGCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-1957s21c1
Sequence:CCGGGAAGATCCGAGAGCGAAATAACTCGAGTTATTTCGCTCTCGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-1918s21c1
Sequence:CCGGCCGGACCCAGAACATTATCATCTCGAGATGATAATGTTCTGGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-2906s21c1
Sequence:CCGGCTCTCTACATACAGGAATAATCTCGAGATTATTCCTGTATGTAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006377.3-5138s21c1
Sequence:GTACCGGGTAACCGGCTTAGGGTCTTTGCTCGAGCAAAGACCCTAAGCCGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-2272s21c1
Sequence:GTACCGGCCGCATTAAGGTGCGTGTATGCTCGAGCATACACGCACCTTAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006377
VALIDATED
UNC13B MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog B (C. elegans)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006377.x-2838s1c1
Sequence:CCGGCTCTCTACATACAGGAATAATCTCGAGATTATTCCTGTATGTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-5245s1c1
Sequence:CCGGCCATTAAGAGAGAAGGACAAACTCGAGTTTGTCCTTCTCTCTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-4739s1c1
Sequence:CCGGCGAGTCCTATGAGTTGCAGATCTCGAGATCTGCAACTCATAGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006377.x-647s1c1
Sequence:CCGGGACCTACAAATGGGAGCAAATCTCGAGATTTGCTCCCATTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006377.x-1850s1c1
Sequence:CCGGCCGGACCCAGAACATTATCATCTCGAGATGATAATGTTCTGGGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-3982s21c1
Sequence:GTACCGGTGATGAGTGTGTTCGACAAATCTCGAGATTTGTCGAACACACTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-586s21c1
Sequence:CCGGATTAGAGGCAGAGACGTTAATCTCGAGATTAACGTCTCTGCCTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006377.3-5313s21c1
Sequence:CCGGCCATTAAGAGAGAAGGACAAACTCGAGTTTGTCCTTCTCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-3100s21c1
Sequence:GTACCGGCAACAACTGCCACGACTTATACTCGAGTATAAGTCGTGGCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-1957s21c1
Sequence:CCGGGAAGATCCGAGAGCGAAATAACTCGAGTTATTTCGCTCTCGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-1918s21c1
Sequence:CCGGCCGGACCCAGAACATTATCATCTCGAGATGATAATGTTCTGGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-2906s21c1
Sequence:CCGGCTCTCTACATACAGGAATAATCTCGAGATTATTCCTGTATGTAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006377.3-5138s21c1
Sequence:GTACCGGGTAACCGGCTTAGGGTCTTTGCTCGAGCAAAGACCCTAAGCCGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006377.3-2272s21c1
Sequence:GTACCGGCCGCATTAAGGTGCGTGTATGCTCGAGCATACACGCACCTTAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081413
VALIDATED
UNC13B MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081413.1-1981s21c1
Sequence:CCGGGAAGATCCGAGAACGGAATAACTCGAGTTATTCCGTTCTCGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081413.1-2792s21c1
Sequence:CCGGGCCAACATCAATGCCTATTATCTCGAGATAATAGGCATTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081413.1-2284s21c1
Sequence:CCGGCAACTCTTCTGATCGAATTAACTCGAGTTAATTCGATCAGAAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081413.1-5172s21c1
Sequence:CCGGTTAGAGTCCTTGTAGTCAAATCTCGAGATTTGACTACAAGGACTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081413.1-1404s21c1
Sequence:CCGGAGACCGCATCATCGCCATTTACTCGAGTAAATGGCGATGATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081413
VALIDATED
UNC13B MISSION shRNA shRNA Plasmid DNA
unc-13 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081413.1-1981s21c1
Sequence:CCGGGAAGATCCGAGAACGGAATAACTCGAGTTATTCCGTTCTCGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081413.1-2792s21c1
Sequence:CCGGGCCAACATCAATGCCTATTATCTCGAGATAATAGGCATTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081413.1-2284s21c1
Sequence:CCGGCAACTCTTCTGATCGAATTAACTCGAGTTAATTCGATCAGAAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081413.1-5172s21c1
Sequence:CCGGTTAGAGTCCTTGTAGTCAAATCTCGAGATTTGACTACAAGGACTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081413.1-1404s21c1
Sequence:CCGGAGACCGCATCATCGCCATTTACTCGAGTAAATGGCGATGATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081413
VALIDATED
UNC13B MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081413.1-1981s21c1
Sequence:CCGGGAAGATCCGAGAACGGAATAACTCGAGTTATTCCGTTCTCGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081413.1-2792s21c1
Sequence:CCGGGCCAACATCAATGCCTATTATCTCGAGATAATAGGCATTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081413.1-2284s21c1
Sequence:CCGGCAACTCTTCTGATCGAATTAACTCGAGTTAATTCGATCAGAAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081413.1-5172s21c1
Sequence:CCGGTTAGAGTCCTTGTAGTCAAATCTCGAGATTTGACTACAAGGACTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081413.1-1404s21c1
Sequence:CCGGAGACCGCATCATCGCCATTTACTCGAGTAAATGGCGATGATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks