EMAIL THIS PAGE TO A FRIEND

UNC13C

unc-13 homolog C (C. elegans)

UniProtKB ID: Q8NB66, Q0P613, Q8ND48, Q96NP3
Gene ID:
Mouse(208898) unc-13 homolog C (C. elegans)
Rat(286931) unc-13 homolog C (C. elegans)
domestic guinea pig(100724025) unc-13 homolog C (C. elegans)
Domestic Rabbit(100352093) unc-13 homolog C (C. elegans)
naked mole-rat(101722108) unc-13 homolog C (C. elegans)
cow(100337128) unc-13 homolog C (C. elegans)
sheep(101123470) unc-13 homolog C (C. elegans)
Zebrafish(100034491) unc-13 homolog C (C. elegans)
chicken(415413) unc-13 homolog C (C. elegans)
dog(487564) unc-13 homolog C (C. elegans)
Horse(100054917) unc-13 homolog C (C. elegans)
domestic cat(101087486) unc-13 homolog C (C. elegans)
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_146948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_146948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_146948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077021 MISSION® esiRNA esiRNA human UNC13C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080534 Rosetta Predictions human pricing
XM_496070 Rosetta Predictions human pricing
XM_930037 Rosetta Predictions human pricing
XM_934230 Rosetta Predictions human pricing
NM_173146 Rosetta Predictions rat pricing
NM_001081153 Rosetta Predictions mouse pricing
XM_146948 Rosetta Predictions mouse pricing
XM_991380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315777 predicted 371
2 SASI_Hs02_00315778 predicted 4647
3 SASI_Hs02_00315779 predicted 4054
4 SASI_Hs02_00315780 predicted 2406
5 SASI_Hs02_00315781 predicted 1830
6 SASI_Hs02_00315782 predicted 4945
7 SASI_Hs02_00315783 predicted 926
8 SASI_Hs02_00315784 predicted 5520
9 SASI_Hs02_00315785 predicted 3459
10 SASI_Hs02_00315786 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247670 predicted 659
2 SASI_Hs01_00247671 predicted 418
3 SASI_Hs01_00247672 predicted 630
4 SASI_Hs01_00247673 predicted 801
5 SASI_Hs01_00247674 predicted 503
6 SASI_Hs01_00247675 predicted 614
7 SASI_Hs01_00247676 predicted 784
8 SASI_Hs01_00247677 predicted 532
9 SASI_Hs01_00247678 predicted 476
10 SASI_Hs01_00247679 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277813 predicted 1708
2 SASI_Hs01_00277814 predicted 2783
3 SASI_Hs01_00277815 predicted 983
4 SASI_Hs01_00277816 predicted 3138
5 SASI_Hs01_00277817 predicted 2952
6 SASI_Hs01_00277818 predicted 1401
7 SASI_Hs01_00277819 predicted 1873
8 SASI_Hs01_00277820 predicted 2458
9 SASI_Hs01_00277821 predicted 392
10 SASI_Hs01_00277822 predicted 2534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257812 predicted 569
2 SASI_Hs01_00257813 predicted 323
3 SASI_Hs01_00257814 predicted 531
4 SASI_Hs01_00257815 predicted 702
5 SASI_Hs01_00257816 predicted 400
6 SASI_Hs01_00257817 predicted 524
7 SASI_Hs01_00257818 predicted 697
8 SASI_Hs01_00257819 predicted 443
9 SASI_Hs01_00257820 predicted 389
10 SASI_Hs01_00257821 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095237 predicted 864
2 SASI_Rn01_00095238 predicted 5308
3 SASI_Rn02_00269328 predicted 4161
4 SASI_Rn01_00095241 predicted 4392
5 SASI_Rn01_00095242 predicted 4169
6 SASI_Rn01_00095243 predicted 822
7 SASI_Rn02_00269329 predicted 3758
8 SASI_Rn01_00095245 predicted 4688
9 SASI_Rn01_00095246 predicted 6569
10 SASI_Rn02_00269330 predicted 2057
11 SASI_Rn01_00095239 predicted 816
12 SASI_Rn01_00095240 predicted 5377
13 SASI_Rn01_00095244 predicted 5000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295701 predicted 1270
2 SASI_Mm02_00295702 predicted 736
3 SASI_Mm02_00295703 predicted 2258
4 SASI_Mm02_00295704 predicted 6172
5 SASI_Mm02_00295705 predicted 1156
6 SASI_Mm02_00295706 predicted 1379
7 SASI_Mm02_00295707 predicted 3655
8 SASI_Mm02_00295708 predicted 5926
9 SASI_Mm02_00295709 predicted 1037
10 SASI_Mm02_00295710 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224152 predicted 3484
2 SASI_Mm01_00224153 predicted 2484
3 SASI_Mm01_00224154 predicted 2481
4 SASI_Mm01_00224155 predicted 3187
5 SASI_Mm01_00224156 predicted 3084
6 SASI_Mm01_00224157 predicted 2538
7 SASI_Mm01_00224158 predicted 2669
8 SASI_Mm01_00224159 predicted 3655
9 SASI_Mm01_00224160 predicted 3728
10 SASI_Mm01_00224161 predicted 2885
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231898 predicted 1888
2 SASI_Mm01_00231899 predicted 897
3 SASI_Mm01_00231900 predicted 919
4 SASI_Mm01_00231901 predicted 1552
5 SASI_Mm01_00231902 predicted 1051
6 SASI_Mm01_00231903 predicted 322
7 SASI_Mm01_00231904 predicted 1204
8 SASI_Mm01_00231905 predicted 1311
9 SASI_Mm01_00231906 predicted 1950
10 SASI_Mm01_00231907 predicted 1970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080534
UNC13C MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog C (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-5913s21c1
Sequence:CCGGGCCAAGACAATGCGCTATAATCTCGAGATTATAGCGCATTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-2331s21c1
Sequence:CCGGATCATGGCATAGTCGATTAAGCTCGAGCTTAATCGACTATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-4323s21c1
Sequence:CCGGGAGCACCTTGCTGGCTAATATCTCGAGATATTAGCCAGCAAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080534.1-7372s21c1
Sequence:CCGGTGTCTTGGCTTTACCATATTTCTCGAGAAATATGGTAAAGCCAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-3484s21c1
Sequence:CCGGGACAAGACTCAGACCATTATTCTCGAGAATAATGGTCTGAGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080534
UNC13C MISSION shRNA shRNA Plasmid DNA
unc-13 homolog C (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-5913s21c1
Sequence:CCGGGCCAAGACAATGCGCTATAATCTCGAGATTATAGCGCATTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-2331s21c1
Sequence:CCGGATCATGGCATAGTCGATTAAGCTCGAGCTTAATCGACTATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-4323s21c1
Sequence:CCGGGAGCACCTTGCTGGCTAATATCTCGAGATATTAGCCAGCAAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080534.1-7372s21c1
Sequence:CCGGTGTCTTGGCTTTACCATATTTCTCGAGAAATATGGTAAAGCCAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-3484s21c1
Sequence:CCGGGACAAGACTCAGACCATTATTCTCGAGAATAATGGTCTGAGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080534
UNC13C MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog C (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-5913s21c1
Sequence:CCGGGCCAAGACAATGCGCTATAATCTCGAGATTATAGCGCATTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-2331s21c1
Sequence:CCGGATCATGGCATAGTCGATTAAGCTCGAGCTTAATCGACTATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-4323s21c1
Sequence:CCGGGAGCACCTTGCTGGCTAATATCTCGAGATATTAGCCAGCAAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080534.1-7372s21c1
Sequence:CCGGTGTCTTGGCTTTACCATATTTCTCGAGAAATATGGTAAAGCCAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080534.1-3484s21c1
Sequence:CCGGGACAAGACTCAGACCATTATTCTCGAGAATAATGGTCTGAGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_146948
UNC13C MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog C (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-2935s1c1
Sequence:CCGGGCTCGAATAGTAAGTGGCAATCTCGAGATTGCCACTTACTATTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-1057s1c1
Sequence:CCGGCCCATCCTAGTGTACTTTGAACTCGAGTTCAAAGTACACTAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-2158s1c1
Sequence:CCGGGCCAATTCTAATGACCTGTATCTCGAGATACAGGTCATTAGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-846s1c1
Sequence:CCGGCCACGATTACATTAAACACTTCTCGAGAAGTGTTTAATGTAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-3420s1c1
Sequence:CCGGCCAGACTATCATCACAGCCATCTCGAGATGGCTGTGATGATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_146948
UNC13C MISSION shRNA shRNA Plasmid DNA
unc-13 homolog C (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-2935s1c1
Sequence:CCGGGCTCGAATAGTAAGTGGCAATCTCGAGATTGCCACTTACTATTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-1057s1c1
Sequence:CCGGCCCATCCTAGTGTACTTTGAACTCGAGTTCAAAGTACACTAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-2158s1c1
Sequence:CCGGGCCAATTCTAATGACCTGTATCTCGAGATACAGGTCATTAGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-846s1c1
Sequence:CCGGCCACGATTACATTAAACACTTCTCGAGAAGTGTTTAATGTAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-3420s1c1
Sequence:CCGGCCAGACTATCATCACAGCCATCTCGAGATGGCTGTGATGATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_146948
UNC13C MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog C (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-2935s1c1
Sequence:CCGGGCTCGAATAGTAAGTGGCAATCTCGAGATTGCCACTTACTATTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-1057s1c1
Sequence:CCGGCCCATCCTAGTGTACTTTGAACTCGAGTTCAAAGTACACTAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-2158s1c1
Sequence:CCGGGCCAATTCTAATGACCTGTATCTCGAGATACAGGTCATTAGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-846s1c1
Sequence:CCGGCCACGATTACATTAAACACTTCTCGAGAAGTGTTTAATGTAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146948.3-3420s1c1
Sequence:CCGGCCAGACTATCATCACAGCCATCTCGAGATGGCTGTGATGATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks