EMAIL THIS PAGE TO A FRIEND

UNC13D

unc-13 homolog D (C. elegans)

Synonyms: FHL3 HLH3 HPLH3 Munc13-4
UniProtKB ID: Q70J99, B4DWG9, Q9H7K5
Gene ID:
Human(201294) Summary: This gene encodes a protein that is a member of the UNC13 family, containing similar domain structure as other family members but lacking an N-terminal phorbol ester-binding C1 domain present in other Munc13 proteins. The protein appears to play a role in vesicle maturation during exocytosis and is involved in regulation of cytolytic granules secretion. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis type 3, a genetically heterogeneous, rare autosomal recessive disorder. [provided by RefSeq, Jul 2008]
Mouse(70450) unc-13 homolog D (C. elegans)
Rat(192177) unc-13 homolog D (C. elegans)
Zebrafish(564076) unc-13 homolog D (C. elegans)
chicken(417369) unc-13 homolog D (C. elegans)
domestic cat(101081343) unc-13 homolog D (C. elegans)
Horse(100059416) unc-13 homolog D (C. elegans)
dog(483319) unc-13 homolog D (C. elegans)
cow(506146) unc-13 homolog D (C. elegans)
sheep(101119148) unc-13 homolog D (C. elegans)
naked mole-rat(101700358) unc-13 homolog D (C. elegans)
domestic guinea pig(100725879) unc-13 homolog D (C. elegans)
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_126670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001009573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001009573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001009573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199242 Rosetta Predictions human pricing
NM_138844 Rosetta Predictions rat pricing
NM_001009573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026167 predicted 1902
2 SASI_Hs01_00026169 predicted 2255
3 SASI_Hs01_00026170 predicted 1391
4 SASI_Hs01_00026171 predicted 751
5 SASI_Hs02_00372677 predicted 2339
6 SASI_Hs01_00026172 predicted 3043
7 SASI_Hs02_00372678 predicted 711
8 SASI_Hs01_00026173 predicted 548
9 SASI_Hs01_00026174 predicted 3300
10 SASI_Hs01_00026176 predicted 3073
11 SASI_Hs01_00026168 predicted 2027
12 SASI_Hs01_00026175 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061242 predicted 1071
2 SASI_Rn01_00061243 predicted 753
3 SASI_Rn01_00061244 predicted 1845
4 SASI_Rn01_00061245 predicted 3089
5 SASI_Rn01_00061246 predicted 714
6 SASI_Rn01_00061247 predicted 706
7 SASI_Rn01_00061248 predicted 1665
8 SASI_Rn01_00061249 predicted 2687
9 SASI_Rn02_00268226 predicted 528
10 SASI_Rn01_00061251 predicted 757
11 SASI_Rn01_00061250 predicted 3508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021062 predicted 1001
2 SASI_Mm01_00021063 predicted 460
3 SASI_Mm02_00286865 predicted 1511
4 SASI_Mm01_00021064 predicted 1739
5 SASI_Mm01_00021065 predicted 642
6 SASI_Mm01_00021066 predicted 1126
7 SASI_Mm01_00021067 predicted 3028
8 SASI_Mm01_00021068 predicted 1639
9 SASI_Mm01_00021069 predicted 1766
10 SASI_Mm01_00021070 predicted 635
11 SASI_Mm01_00021071 predicted 2981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126670
UNC13D MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog D (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2445s1c1
Sequence:CCGGGCTTTGCTACATGAACACCAACTCGAGTTGGTGTTCATGTAGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-1943s1c1
Sequence:CCGGCTACCTGCTTTGCCCAAATTACTCGAGTAATTTGGGCAAAGCAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2052s1c1
Sequence:CCGGCCTGGTCTACTGTAGCCTTATCTCGAGATAAGGCTACAGTAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2367s1c1
Sequence:CCGGCCAGAAACTCATTGGCGTCAACTCGAGTTGACGCCAATGAGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-516s1c1
Sequence:CCGGCGAGACCTTTATCTTGGAGTTCTCGAGAACTCCAAGATAAAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126670
UNC13D MISSION shRNA shRNA Plasmid DNA
unc-13 homolog D (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2445s1c1
Sequence:CCGGGCTTTGCTACATGAACACCAACTCGAGTTGGTGTTCATGTAGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-1943s1c1
Sequence:CCGGCTACCTGCTTTGCCCAAATTACTCGAGTAATTTGGGCAAAGCAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2052s1c1
Sequence:CCGGCCTGGTCTACTGTAGCCTTATCTCGAGATAAGGCTACAGTAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2367s1c1
Sequence:CCGGCCAGAAACTCATTGGCGTCAACTCGAGTTGACGCCAATGAGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-516s1c1
Sequence:CCGGCGAGACCTTTATCTTGGAGTTCTCGAGAACTCCAAGATAAAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126670
UNC13D MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog D (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2445s1c1
Sequence:CCGGGCTTTGCTACATGAACACCAACTCGAGTTGGTGTTCATGTAGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-1943s1c1
Sequence:CCGGCTACCTGCTTTGCCCAAATTACTCGAGTAATTTGGGCAAAGCAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2052s1c1
Sequence:CCGGCCTGGTCTACTGTAGCCTTATCTCGAGATAAGGCTACAGTAGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-2367s1c1
Sequence:CCGGCCAGAAACTCATTGGCGTCAACTCGAGTTGACGCCAATGAGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126670.3-516s1c1
Sequence:CCGGCGAGACCTTTATCTTGGAGTTCTCGAGAACTCCAAGATAAAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199242
VALIDATED
UNC13D MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog D (C. elegans)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-1691s1c1
Sequence:CCGGGATGTGCAAGATGAAGGCCTTCTCGAGAAGGCCTTCATCTTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-936s1c1
Sequence:CCGGGAGACCTTCATCCTGGAGTTTCTCGAGAAACTCCAGGATGAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199242.1-3296s1c1
Sequence:CCGGGAAGGACCTTCACCCATTGTTCTCGAGAACAATGGGTGAAGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-2345s1c1
Sequence:CCGGCTTCATGATTACCGTCAAGTTCTCGAGAACTTGACGGTAATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-2783s1c1
Sequence:CCGGGCTTTGCTACATGAACACCAACTCGAGTTGGTGTTCATGTAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-1913s1c1
Sequence:CCGGGATCTTCCACAATACCCTCAACTCGAGTTGAGGGTATTGTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199242.1-2344s1c1
Sequence:CCGGCCTTCATGATTACCGTCAAGTCTCGAGACTTGACGGTAATCATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2347s21c1
Sequence:GTACCGGTCATGATTACCGTCAAGTTTGCTCGAGCAAACTTGACGGTAATCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-3298s21c1
Sequence:GTACCGGAGGACCTTCACCCATTGTTTGCTCGAGCAAACAATGGGTGAAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-1087s21c1
Sequence:GTACCGGACAAAGGCCAGGACGACTTTCCTCGAGGAAAGTCGTCCTGGCCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2113s21c1
Sequence:GTACCGGGAGTCCTGGCCCTGGATAATTCTCGAGAATTATCCAGGGCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2261s21c1
Sequence:GTACCGGCACATCAGCGGTGGATCTATCCTCGAGGATAGATCCACCGCTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2393s21c1
Sequence:GTACCGGGGTGTACTGCAGCCTTATAAACTCGAGTTTATAAGGCTGCAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199242
VALIDATED
UNC13D MISSION shRNA shRNA Plasmid DNA
unc-13 homolog D (C. elegans)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-1691s1c1
Sequence:CCGGGATGTGCAAGATGAAGGCCTTCTCGAGAAGGCCTTCATCTTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-936s1c1
Sequence:CCGGGAGACCTTCATCCTGGAGTTTCTCGAGAAACTCCAGGATGAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199242.1-3296s1c1
Sequence:CCGGGAAGGACCTTCACCCATTGTTCTCGAGAACAATGGGTGAAGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-2345s1c1
Sequence:CCGGCTTCATGATTACCGTCAAGTTCTCGAGAACTTGACGGTAATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-2783s1c1
Sequence:CCGGGCTTTGCTACATGAACACCAACTCGAGTTGGTGTTCATGTAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-1913s1c1
Sequence:CCGGGATCTTCCACAATACCCTCAACTCGAGTTGAGGGTATTGTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199242.1-2344s1c1
Sequence:CCGGCCTTCATGATTACCGTCAAGTCTCGAGACTTGACGGTAATCATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2347s21c1
Sequence:GTACCGGTCATGATTACCGTCAAGTTTGCTCGAGCAAACTTGACGGTAATCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-3298s21c1
Sequence:GTACCGGAGGACCTTCACCCATTGTTTGCTCGAGCAAACAATGGGTGAAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-1087s21c1
Sequence:GTACCGGACAAAGGCCAGGACGACTTTCCTCGAGGAAAGTCGTCCTGGCCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2113s21c1
Sequence:GTACCGGGAGTCCTGGCCCTGGATAATTCTCGAGAATTATCCAGGGCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2261s21c1
Sequence:GTACCGGCACATCAGCGGTGGATCTATCCTCGAGGATAGATCCACCGCTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2393s21c1
Sequence:GTACCGGGGTGTACTGCAGCCTTATAAACTCGAGTTTATAAGGCTGCAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199242
VALIDATED
UNC13D MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog D (C. elegans)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-1691s1c1
Sequence:CCGGGATGTGCAAGATGAAGGCCTTCTCGAGAAGGCCTTCATCTTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-936s1c1
Sequence:CCGGGAGACCTTCATCCTGGAGTTTCTCGAGAAACTCCAGGATGAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199242.1-3296s1c1
Sequence:CCGGGAAGGACCTTCACCCATTGTTCTCGAGAACAATGGGTGAAGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-2345s1c1
Sequence:CCGGCTTCATGATTACCGTCAAGTTCTCGAGAACTTGACGGTAATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-2783s1c1
Sequence:CCGGGCTTTGCTACATGAACACCAACTCGAGTTGGTGTTCATGTAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_199242.1-1913s1c1
Sequence:CCGGGATCTTCCACAATACCCTCAACTCGAGTTGAGGGTATTGTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199242.1-2344s1c1
Sequence:CCGGCCTTCATGATTACCGTCAAGTCTCGAGACTTGACGGTAATCATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2347s21c1
Sequence:GTACCGGTCATGATTACCGTCAAGTTTGCTCGAGCAAACTTGACGGTAATCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-3298s21c1
Sequence:GTACCGGAGGACCTTCACCCATTGTTTGCTCGAGCAAACAATGGGTGAAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-1087s21c1
Sequence:GTACCGGACAAAGGCCAGGACGACTTTCCTCGAGGAAAGTCGTCCTGGCCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2113s21c1
Sequence:GTACCGGGAGTCCTGGCCCTGGATAATTCTCGAGAATTATCCAGGGCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2261s21c1
Sequence:GTACCGGCACATCAGCGGTGGATCTATCCTCGAGGATAGATCCACCGCTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199242.2-2393s21c1
Sequence:GTACCGGGGTGTACTGCAGCCTTATAAACTCGAGTTTATAAGGCTGCAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009573
UNC13D MISSION shRNA Bacterial Glycerol Stock
unc-13 homolog D (C. elegans)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000379660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-2121s21c1
Sequence:GTACCGGGGTCTACTGTAGCCTTATAAACTCGAGTTTATAAGGCTACAGTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-1625s21c1
Sequence:GTACCGGGTCGCACATGGAACAAGATTTCTCGAGAAATCTTGTTCCATGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-2198s21c1
Sequence:GTACCGGTGCTGTGTGTGGTGGTAAATACTCGAGTATTTACCACCACACACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009573
UNC13D MISSION shRNA shRNA Plasmid DNA
unc-13 homolog D (C. elegans)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000379660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-2121s21c1
Sequence:GTACCGGGGTCTACTGTAGCCTTATAAACTCGAGTTTATAAGGCTACAGTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-1625s21c1
Sequence:GTACCGGGTCGCACATGGAACAAGATTTCTCGAGAAATCTTGTTCCATGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-2198s21c1
Sequence:GTACCGGTGCTGTGTGTGGTGGTAAATACTCGAGTATTTACCACCACACACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009573
UNC13D MISSION shRNA Lentiviral Transduction Particles
unc-13 homolog D (C. elegans)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000379660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-2121s21c1
Sequence:GTACCGGGGTCTACTGTAGCCTTATAAACTCGAGTTTATAAGGCTACAGTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-1625s21c1
Sequence:GTACCGGGTCGCACATGGAACAAGATTTCTCGAGAAATCTTGTTCCATGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009573.2-2198s21c1
Sequence:GTACCGGTGCTGTGTGTGGTGGTAAATACTCGAGTATTTACCACCACACACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks