EMAIL THIS PAGE TO A FRIEND

UNC45A

unc-45 homolog A (C. elegans)

Synonyms: GC-UNC45 GCUNC-45 GCUNC45 IRO039700 SMAP-1 SMAP1
UniProtKB ID: Q9H3U1, A8K6F7, Q7L3Y6, Q9H3U8, Q9NSE8, Q9NSE9
Gene ID:
Human(55898) Summary: UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]
Mouse(101869) unc-45 homolog A (C. elegans)
Rat(308759) unc-45 homolog A (C. elegans)
domestic guinea pig(100727800) unc-45 homolog A (C. elegans)
naked mole-rat(101715722) unc-45 homolog A (C. elegans)
cow(535692) unc-45 homolog A (C. elegans)
sheep(101106286) unc-45 homolog A (C. elegans)
Zebrafish(550364) unc-45 homolog A (C. elegans)
Horse(100053485) unc-45 homolog A (C. elegans)
domestic cat(101080539) unc-45 homolog A (C. elegans)
dog(488743) unc-45 homolog A (C. elegans)
chicken(415584) unc-45 homolog A (C. elegans)
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018671 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039675 Rosetta Predictions human pricing
NM_018671 Rosetta Predictions human pricing
NM_001037647 Rosetta Predictions rat pricing
NM_133952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191556 predicted 3578
2 SASI_Hs01_00191557 predicted 2326
3 SASI_Hs01_00191559 predicted 2799
4 SASI_Hs01_00191560 predicted 3135
5 SASI_Hs01_00191562 predicted 3509
6 SASI_Hs01_00191563 predicted 1351
7 SASI_Hs01_00191564 predicted 3493
8 SASI_Hs01_00191565 predicted 1951
9 SASI_Hs02_00308636 predicted 2236
10 SASI_Hs02_00308637 predicted 3601
11 SASI_Hs01_00191558 predicted 2204
12 SASI_Hs01_00191561 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197131 predicted 3133
2 SASI_Hs01_00197132 predicted 1874
3 SASI_Hs01_00197134 predicted 2346
4 SASI_Hs01_00197135 predicted 2683
5 SASI_Hs01_00197137 predicted 3060
6 SASI_Hs01_00197138 predicted 902
7 SASI_Hs01_00197139 predicted 3046
8 SASI_Hs01_00197140 predicted 1503
9 SASI_Hs02_00352186 predicted 1789
10 SASI_Hs02_00352187 predicted 3153
11 SASI_Hs01_00197133 predicted 1757
12 SASI_Hs01_00197136 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117365 predicted 2918
2 SASI_Rn01_00117366 predicted 567
3 SASI_Rn01_00117368 predicted 1414
4 SASI_Rn01_00117370 predicted 1660
5 SASI_Rn01_00117371 predicted 1130
6 SASI_Rn01_00117372 predicted 2516
7 SASI_Rn01_00117373 predicted 1855
8 SASI_Rn01_00117374 predicted 2498
9 SASI_Rn02_00204518 predicted 2904
10 SASI_Rn02_00204519 predicted 1832
11 SASI_Rn01_00117367 predicted 1114
12 SASI_Rn01_00117369 predicted 1922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043014 predicted 2027
2 SASI_Mm01_00043015 predicted 1626
3 SASI_Mm01_00043016 predicted 2187
4 SASI_Mm01_00043017 predicted 1381
5 SASI_Mm01_00043018 predicted 2425
6 SASI_Mm01_00043020 predicted 2874
7 SASI_Mm01_00043021 predicted 3014
8 SASI_Mm01_00043023 predicted 1612
9 SASI_Mm02_00339060 predicted 1793
10 SASI_Mm02_00339061 predicted 427
11 SASI_Mm01_00043019 predicted 1642
12 SASI_Mm01_00043022 predicted 2883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133952
VALIDATED
UNC45A MISSION shRNA Bacterial Glycerol Stock
unc-45 homolog A (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-2992s21c1
Sequence:CCGGGCACTGGGATGCTCGATACTTCTCGAGAAGTATCGAGCATCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133952.2-1410s21c1
Sequence:CCGGGTGTCATGGAGAGCGTGATAGCTCGAGCTATCACGCTCTCCATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-2033s21c1
Sequence:CCGGGTGTCAGCCATGACGTGTATGCTCGAGCATACACGTCATGGCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-330s21c1
Sequence:CCGGCAGAATCAGAGGCGTCTAAAGCTCGAGCTTTAGACGCCTCTGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133952.2-1866s21c1
Sequence:CCGGTAGGCTCGGCATTGGTCAATTCTCGAGAATTGACCAATGCCGAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133952.1-3020s1c1
Sequence:CCGGCCACAGTTGCACTTTGGTGTTCTCGAGAACACCAAAGTGCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133952.1-1265s1c1
Sequence:CCGGCCGACTCTGTGAGAACTACATCTCGAGATGTAGTTCTCACAGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133952.1-609s1c1
Sequence:CCGGGCTTCTCAGAACCTTGTGGTACTCGAGTACCACAAGGTTCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133952.1-318s1c1
Sequence:CCGGGCAGAATCAGAGGCGTCTAAACTCGAGTTTAGACGCCTCTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133952.1-1961s1c1
Sequence:CCGGCCCTAAGGACAAACCAAGCTTCTCGAGAAGCTTGGTTTGTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133952
VALIDATED
UNC45A MISSION shRNA shRNA Plasmid DNA
unc-45 homolog A (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-2992s21c1
Sequence:CCGGGCACTGGGATGCTCGATACTTCTCGAGAAGTATCGAGCATCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133952.2-1410s21c1
Sequence:CCGGGTGTCATGGAGAGCGTGATAGCTCGAGCTATCACGCTCTCCATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-2033s21c1
Sequence:CCGGGTGTCAGCCATGACGTGTATGCTCGAGCATACACGTCATGGCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-330s21c1
Sequence:CCGGCAGAATCAGAGGCGTCTAAAGCTCGAGCTTTAGACGCCTCTGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133952.2-1866s21c1
Sequence:CCGGTAGGCTCGGCATTGGTCAATTCTCGAGAATTGACCAATGCCGAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133952.1-3020s1c1
Sequence:CCGGCCACAGTTGCACTTTGGTGTTCTCGAGAACACCAAAGTGCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133952.1-1265s1c1
Sequence:CCGGCCGACTCTGTGAGAACTACATCTCGAGATGTAGTTCTCACAGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133952.1-609s1c1
Sequence:CCGGGCTTCTCAGAACCTTGTGGTACTCGAGTACCACAAGGTTCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133952.1-318s1c1
Sequence:CCGGGCAGAATCAGAGGCGTCTAAACTCGAGTTTAGACGCCTCTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133952.1-1961s1c1
Sequence:CCGGCCCTAAGGACAAACCAAGCTTCTCGAGAAGCTTGGTTTGTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133952
VALIDATED
UNC45A MISSION shRNA Lentiviral Transduction Particles
unc-45 homolog A (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-2992s21c1
Sequence:CCGGGCACTGGGATGCTCGATACTTCTCGAGAAGTATCGAGCATCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133952.2-1410s21c1
Sequence:CCGGGTGTCATGGAGAGCGTGATAGCTCGAGCTATCACGCTCTCCATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-2033s21c1
Sequence:CCGGGTGTCAGCCATGACGTGTATGCTCGAGCATACACGTCATGGCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133952.2-330s21c1
Sequence:CCGGCAGAATCAGAGGCGTCTAAAGCTCGAGCTTTAGACGCCTCTGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133952.2-1866s21c1
Sequence:CCGGTAGGCTCGGCATTGGTCAATTCTCGAGAATTGACCAATGCCGAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133952.1-3020s1c1
Sequence:CCGGCCACAGTTGCACTTTGGTGTTCTCGAGAACACCAAAGTGCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133952.1-1265s1c1
Sequence:CCGGCCGACTCTGTGAGAACTACATCTCGAGATGTAGTTCTCACAGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133952.1-609s1c1
Sequence:CCGGGCTTCTCAGAACCTTGTGGTACTCGAGTACCACAAGGTTCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133952.1-318s1c1
Sequence:CCGGGCAGAATCAGAGGCGTCTAAACTCGAGTTTAGACGCCTCTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133952.1-1961s1c1
Sequence:CCGGCCCTAAGGACAAACCAAGCTTCTCGAGAAGCTTGGTTTGTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018671
VALIDATED
UNC45A MISSION shRNA Bacterial Glycerol Stock
unc-45 homolog A (C. elegans)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-3199s21c1
Sequence:CCGGCTCATGCACACGCTACCTATTCTCGAGAATAGGTAGCGTGTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-541s21c1
Sequence:CCGGCCACCTCAAGCTGGAAGATTACTCGAGTAATCTTCCAGCTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-791s21c1
Sequence:CCGGGCCAAAGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-3134s21c1
Sequence:CCGGGTGGAATATGGGCTTATCCAACTCGAGTTGGATAAGCCCATATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-905s21c1
Sequence:CCGGGAGAAGATCTTCCGGAGTAATCTCGAGATTACTCCGGAAGATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2881s1c1
Sequence:CCGGCTCATGCACACGCTACCTATTCTCGAGAATAGGTAGCGTGTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-251s1c1
Sequence:CCGGGCAGAAACAGAGGCATCCAAACTCGAGTTTGGATGCCTCTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2816s1c1
Sequence:CCGGGTGGAATATGGGCTTATCCAACTCGAGTTGGATAAGCCCATATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-223s1c1
Sequence:CCGGCCACCTCAAGCTGGAAGATTACTCGAGTAATCTTCCAGCTTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2353s1c1
Sequence:CCGGGCCCATGATAGAAGGCTACATCTCGAGATGTAGCCTTCTATCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-1462s1c1
Sequence:CCGGGCTGCTGAAGGACCTATATAACTCGAGTTATATAGGTCCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-587s1c1
Sequence:CCGGGAGAAGATCTTCCGGAGTAATCTCGAGATTACTCCGGAAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-236s1c1
Sequence:CCGGGAAGATTACGACAAAGCAGAACTCGAGTTCTGCTTTGTCGTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-473s1c1
Sequence:CCGGGCCAAAGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018671
VALIDATED
UNC45A MISSION shRNA shRNA Plasmid DNA
unc-45 homolog A (C. elegans)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-3199s21c1
Sequence:CCGGCTCATGCACACGCTACCTATTCTCGAGAATAGGTAGCGTGTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-541s21c1
Sequence:CCGGCCACCTCAAGCTGGAAGATTACTCGAGTAATCTTCCAGCTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-791s21c1
Sequence:CCGGGCCAAAGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-3134s21c1
Sequence:CCGGGTGGAATATGGGCTTATCCAACTCGAGTTGGATAAGCCCATATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-905s21c1
Sequence:CCGGGAGAAGATCTTCCGGAGTAATCTCGAGATTACTCCGGAAGATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2881s1c1
Sequence:CCGGCTCATGCACACGCTACCTATTCTCGAGAATAGGTAGCGTGTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-251s1c1
Sequence:CCGGGCAGAAACAGAGGCATCCAAACTCGAGTTTGGATGCCTCTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2816s1c1
Sequence:CCGGGTGGAATATGGGCTTATCCAACTCGAGTTGGATAAGCCCATATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-223s1c1
Sequence:CCGGCCACCTCAAGCTGGAAGATTACTCGAGTAATCTTCCAGCTTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2353s1c1
Sequence:CCGGGCCCATGATAGAAGGCTACATCTCGAGATGTAGCCTTCTATCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-1462s1c1
Sequence:CCGGGCTGCTGAAGGACCTATATAACTCGAGTTATATAGGTCCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-587s1c1
Sequence:CCGGGAGAAGATCTTCCGGAGTAATCTCGAGATTACTCCGGAAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-236s1c1
Sequence:CCGGGAAGATTACGACAAAGCAGAACTCGAGTTCTGCTTTGTCGTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-473s1c1
Sequence:CCGGGCCAAAGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018671
VALIDATED
UNC45A MISSION shRNA Lentiviral Transduction Particles
unc-45 homolog A (C. elegans)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-3199s21c1
Sequence:CCGGCTCATGCACACGCTACCTATTCTCGAGAATAGGTAGCGTGTGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-541s21c1
Sequence:CCGGCCACCTCAAGCTGGAAGATTACTCGAGTAATCTTCCAGCTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-791s21c1
Sequence:CCGGGCCAAAGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-3134s21c1
Sequence:CCGGGTGGAATATGGGCTTATCCAACTCGAGTTGGATAAGCCCATATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018671.3-905s21c1
Sequence:CCGGGAGAAGATCTTCCGGAGTAATCTCGAGATTACTCCGGAAGATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2881s1c1
Sequence:CCGGCTCATGCACACGCTACCTATTCTCGAGAATAGGTAGCGTGTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-251s1c1
Sequence:CCGGGCAGAAACAGAGGCATCCAAACTCGAGTTTGGATGCCTCTGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2816s1c1
Sequence:CCGGGTGGAATATGGGCTTATCCAACTCGAGTTGGATAAGCCCATATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-223s1c1
Sequence:CCGGCCACCTCAAGCTGGAAGATTACTCGAGTAATCTTCCAGCTTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-2353s1c1
Sequence:CCGGGCCCATGATAGAAGGCTACATCTCGAGATGTAGCCTTCTATCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-1462s1c1
Sequence:CCGGGCTGCTGAAGGACCTATATAACTCGAGTTATATAGGTCCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-587s1c1
Sequence:CCGGGAGAAGATCTTCCGGAGTAATCTCGAGATTACTCCGGAAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-236s1c1
Sequence:CCGGGAAGATTACGACAAAGCAGAACTCGAGTTCTGCTTTGTCGTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018671.2-473s1c1
Sequence:CCGGGCCAAAGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks