EMAIL THIS PAGE TO A FRIEND

UNC45B

unc-45 homolog B (C. elegans)

Synonyms: CMYA4 SMUNC45 UNC45
UniProtKB ID: Q8IWX7, Q495Q8, Q495Q9
Gene ID:
Human(146862) Summary: UNC45B plays a role in myoblast fusion and sarcomere organization (Price et al., 2002 [PubMed 12356907]
Mouse(217012) unc-45 homolog B (C. elegans)
Rat(303373) unc-45 homolog B (C. elegans)
Zebrafish(266640) unc-45 homolog B (C. elegans)
chicken(417527) unc-45 homolog B (C. elegans)
Horse(100058135) unc-45 homolog B (C. elegans)
domestic cat(101099256) unc-45 homolog B (C. elegans)
dog(480606) unc-45 homolog B (C. elegans)
cow(535385) unc-45 homolog B (C. elegans)
sheep(101117257) unc-45 homolog B (C. elegans)
naked mole-rat(101706755) unc-45 homolog B (C. elegans)
Domestic Rabbit(100346230) unc-45 homolog B (C. elegans)
domestic guinea pig(100715234) unc-45 homolog B (C. elegans)
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047001 MISSION® esiRNA esiRNA human UNC45B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033576 Rosetta Predictions human pricing
NM_173167 Rosetta Predictions human pricing
NM_001107028 Rosetta Predictions rat pricing
NM_178680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111638 predicted 2347
2 SASI_Hs01_00111639 predicted 2604
3 SASI_Hs01_00111640 predicted 1993
4 SASI_Hs01_00111641 predicted 2372
5 SASI_Hs01_00111642 predicted 739
6 SASI_Hs01_00111643 predicted 2393
7 SASI_Hs01_00111644 predicted 2982
8 SASI_Hs01_00111645 predicted 1344
9 SASI_Hs01_00111647 predicted 2473
10 SASI_Hs02_00308065 predicted 2438
11 SASI_Hs01_00111646 predicted 2937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022741 predicted 2354
2 SASI_Hs01_00022742 predicted 2607
3 SASI_Hs01_00022743 predicted 1993
4 SASI_Hs01_00022744 predicted 2386
5 SASI_Hs01_00022745 predicted 735
6 SASI_Hs01_00022746 predicted 2395
7 SASI_Hs01_00022747 predicted 2990
8 SASI_Hs01_00022748 predicted 1347
9 SASI_Hs01_00022750 predicted 2477
10 SASI_Hs02_00368136 predicted 2446
11 SASI_Hs01_00022749 predicted 2950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224776 predicted 2170
2 SASI_Rn02_00224777 predicted 1638
3 SASI_Rn02_00224778 predicted 1616
4 SASI_Rn02_00224779 predicted 1174
5 SASI_Rn02_00224780 predicted 1438
6 SASI_Rn02_00224781 predicted 523
7 SASI_Rn02_00224782 predicted 763
8 SASI_Rn02_00224783 predicted 2681
9 SASI_Rn02_00224784 predicted 1409
10 SASI_Rn02_00224785 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112224 predicted 1166
2 SASI_Mm01_00112225 predicted 2549
3 SASI_Mm01_00112226 predicted 2922
4 SASI_Mm01_00112227 predicted 1177
5 SASI_Mm01_00112228 predicted 458
6 SASI_Mm01_00112230 predicted 252
7 SASI_Mm01_00112231 predicted 454
8 SASI_Mm01_00112232 predicted 1174
9 SASI_Mm01_00112233 predicted 1904
10 SASI_Mm02_00349155 predicted 1535
11 SASI_Mm01_00112229 predicted 2898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173167
UNC45B MISSION shRNA Bacterial Glycerol Stock
unc-45 homolog B (C. elegans)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2286s1c1
Sequence:CCGGCTTGCCAGACATCGAGAACTACTCGAGTAGTTCTCGATGTCTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-955s1c1
Sequence:CCGGCGTACCATCTATGTGGTGGATCTCGAGATCCACCACATAGATGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2289s1c1
Sequence:CCGGGCCAGACATCGAGAACTACATCTCGAGATGTAGTTCTCGATGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-1072s1c1
Sequence:CCGGCTCATCAACAAGCTCTATGATCTCGAGATCATAGAGCTTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2298s1c1
Sequence:CCGGCGAGAACTACATGTTTGAGAACTCGAGTTCTCAAACATGTAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-937s1c1
Sequence:CCGGGCCATTCATGACAACTCACGTCTCGAGACGTGAGTTGTCATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-475s1c1
Sequence:CCGGGCCAACAATCTCATTGTCCTACTCGAGTAGGACAATGAGATTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173167.2-1225s21c1
Sequence:CCGGCAAGATCTGTGAGGAATATATCTCGAGATATATTCCTCACAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173167.2-2994s21c1
Sequence:CCGGTGACAATGAAGTCTCAATATACTCGAGTATATTGAGACTTCATTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173167
UNC45B MISSION shRNA shRNA Plasmid DNA
unc-45 homolog B (C. elegans)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2286s1c1
Sequence:CCGGCTTGCCAGACATCGAGAACTACTCGAGTAGTTCTCGATGTCTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-955s1c1
Sequence:CCGGCGTACCATCTATGTGGTGGATCTCGAGATCCACCACATAGATGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2289s1c1
Sequence:CCGGGCCAGACATCGAGAACTACATCTCGAGATGTAGTTCTCGATGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-1072s1c1
Sequence:CCGGCTCATCAACAAGCTCTATGATCTCGAGATCATAGAGCTTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2298s1c1
Sequence:CCGGCGAGAACTACATGTTTGAGAACTCGAGTTCTCAAACATGTAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-937s1c1
Sequence:CCGGGCCATTCATGACAACTCACGTCTCGAGACGTGAGTTGTCATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-475s1c1
Sequence:CCGGGCCAACAATCTCATTGTCCTACTCGAGTAGGACAATGAGATTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173167.2-1225s21c1
Sequence:CCGGCAAGATCTGTGAGGAATATATCTCGAGATATATTCCTCACAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173167.2-2994s21c1
Sequence:CCGGTGACAATGAAGTCTCAATATACTCGAGTATATTGAGACTTCATTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173167
UNC45B MISSION shRNA Lentiviral Transduction Particles
unc-45 homolog B (C. elegans)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2286s1c1
Sequence:CCGGCTTGCCAGACATCGAGAACTACTCGAGTAGTTCTCGATGTCTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-955s1c1
Sequence:CCGGCGTACCATCTATGTGGTGGATCTCGAGATCCACCACATAGATGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2289s1c1
Sequence:CCGGGCCAGACATCGAGAACTACATCTCGAGATGTAGTTCTCGATGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-1072s1c1
Sequence:CCGGCTCATCAACAAGCTCTATGATCTCGAGATCATAGAGCTTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-2298s1c1
Sequence:CCGGCGAGAACTACATGTTTGAGAACTCGAGTTCTCAAACATGTAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-937s1c1
Sequence:CCGGGCCATTCATGACAACTCACGTCTCGAGACGTGAGTTGTCATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173167.1-475s1c1
Sequence:CCGGGCCAACAATCTCATTGTCCTACTCGAGTAGGACAATGAGATTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173167.2-1225s21c1
Sequence:CCGGCAAGATCTGTGAGGAATATATCTCGAGATATATTCCTCACAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173167.2-2994s21c1
Sequence:CCGGTGACAATGAAGTCTCAATATACTCGAGTATATTGAGACTTCATTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178680
UNC45B MISSION shRNA Bacterial Glycerol Stock
unc-45 homolog B (C. elegans)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-2434s1c1
Sequence:CCGGCGATGGGAATGATCGTCTGAACTCGAGTTCAGACGATCATTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-995s1c1
Sequence:CCGGCGCACCATCTATGTTGTAGATCTCGAGATCTACAACATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-1441s1c1
Sequence:CCGGGCAGATCTACAAGACCACAAACTCGAGTTTGTGGTCTTGTAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-263s1c1
Sequence:CCGGGCTGACATCAAAGCATTGTATCTCGAGATACAATGCTTTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178680.3-3321s1c1
Sequence:CCGGGCCACCCGATTTCAATGGTAACTCGAGTTACCATTGAAATCGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1037s21c1
Sequence:CCGGGGACCTGTCCATTCATGACAACTCGAGTTGTCATGAATGGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1000s21c1
Sequence:CCGGAGGCACTGAACCTGCTTAATACTCGAGTATTAAGCAGGTTCAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1051s21c1
Sequence:CCGGATGACAACTCACGCACCATCTCTCGAGAGATGGTGCGTGAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178680
UNC45B MISSION shRNA shRNA Plasmid DNA
unc-45 homolog B (C. elegans)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-2434s1c1
Sequence:CCGGCGATGGGAATGATCGTCTGAACTCGAGTTCAGACGATCATTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-995s1c1
Sequence:CCGGCGCACCATCTATGTTGTAGATCTCGAGATCTACAACATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-1441s1c1
Sequence:CCGGGCAGATCTACAAGACCACAAACTCGAGTTTGTGGTCTTGTAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-263s1c1
Sequence:CCGGGCTGACATCAAAGCATTGTATCTCGAGATACAATGCTTTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178680.3-3321s1c1
Sequence:CCGGGCCACCCGATTTCAATGGTAACTCGAGTTACCATTGAAATCGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1037s21c1
Sequence:CCGGGGACCTGTCCATTCATGACAACTCGAGTTGTCATGAATGGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1000s21c1
Sequence:CCGGAGGCACTGAACCTGCTTAATACTCGAGTATTAAGCAGGTTCAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1051s21c1
Sequence:CCGGATGACAACTCACGCACCATCTCTCGAGAGATGGTGCGTGAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178680
UNC45B MISSION shRNA Lentiviral Transduction Particles
unc-45 homolog B (C. elegans)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-2434s1c1
Sequence:CCGGCGATGGGAATGATCGTCTGAACTCGAGTTCAGACGATCATTCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-995s1c1
Sequence:CCGGCGCACCATCTATGTTGTAGATCTCGAGATCTACAACATAGATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-1441s1c1
Sequence:CCGGGCAGATCTACAAGACCACAAACTCGAGTTTGTGGTCTTGTAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178680.3-263s1c1
Sequence:CCGGGCTGACATCAAAGCATTGTATCTCGAGATACAATGCTTTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178680.3-3321s1c1
Sequence:CCGGGCCACCCGATTTCAATGGTAACTCGAGTTACCATTGAAATCGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1037s21c1
Sequence:CCGGGGACCTGTCCATTCATGACAACTCGAGTTGTCATGAATGGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1000s21c1
Sequence:CCGGAGGCACTGAACCTGCTTAATACTCGAGTATTAAGCAGGTTCAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178680.4-1051s21c1
Sequence:CCGGATGACAACTCACGCACCATCTCTCGAGAGATGGTGCGTGAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks