EMAIL THIS PAGE TO A FRIEND

UNC50

unc-50 homolog (C. elegans)

Synonyms: GMH1 UNCL URP
Gene ID:
Mouse(67387) unc-50 homolog (C. elegans)
Rat(192356) unc-50 homolog (C. elegans)
domestic guinea pig(100724205) unc-50 homolog (C. elegans)
naked mole-rat(101721687) unc-50 homolog (C. elegans)
cow(513629) unc-50 homolog (C. elegans)
sheep(101109083) unc-50 homolog (C. elegans)
Zebrafish(393217) unc-50 homolog (C. elegans)
domestic cat(101088401) unc-50 homolog (C. elegans)
chicken(418691) unc-50 homolog (C. elegans)
dog(611651) unc-50 homolog (C. elegans)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA027009 Anti-UNC50 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2102650 Anti-UNC50 antibody produced in rabbit affinity isolated antibody mouse, bovine, human, guinea pig, rabbit, horse, rat, zebrafish, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014044 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081881 MISSION® esiRNA esiRNA targeting mouse Unc50 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014044 Rosetta Predictions human pricing
NM_138919 Rosetta Predictions rat pricing
NM_026123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345038 predicted 519
2 SASI_Hs02_00345039 predicted 551
3 SASI_Hs01_00176552 predicted 529
4 SASI_Hs02_00345040 predicted 467
5 SASI_Hs01_00176554 predicted 447
6 SASI_Hs01_00176555 predicted 560
7 SASI_Hs01_00176556 predicted 880
8 SASI_Hs01_00176557 predicted 486
9 SASI_Hs02_00345041 predicted 436
10 SASI_Hs01_00176558 predicted 531
11 SASI_Hs01_00176550 predicted 1195
12 SASI_Hs01_00176551 predicted 1820
13 SASI_Hs01_00176553 predicted 1306
14 SASI_Hs01_00176559 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063775 predicted 864
2 SASI_Rn01_00063776 predicted 823
3 SASI_Rn01_00063777 predicted 237
4 SASI_Rn01_00063778 predicted 410
5 SASI_Rn01_00063779 predicted 694
6 SASI_Rn01_00063780 predicted 367
7 SASI_Rn01_00063781 predicted 231
8 SASI_Rn01_00063782 predicted 788
9 SASI_Rn01_00063783 predicted 720
10 SASI_Rn01_00063784 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132281 predicted 1137
2 SASI_Mm01_00132282 predicted 958
3 SASI_Mm01_00132283 predicted 1091
4 SASI_Mm01_00132284 predicted 1052
5 SASI_Mm01_00132285 predicted 804
6 SASI_Mm01_00132286 predicted 900
7 SASI_Mm01_00132287 predicted 862
8 SASI_Mm01_00132288 predicted 569
9 SASI_Mm01_00132289 predicted 484
10 SASI_Mm01_00132290 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026123
VALIDATED
UNC50 MISSION shRNA Bacterial Glycerol Stock
unc-50 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-704s21c1
Sequence:CCGGCCTTCTGATCTCAACGTTAATCTCGAGATTAACGTTGAGATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-1045s21c1
Sequence:CCGGTGGCACTGGGATGGAACTTTACTCGAGTAAAGTTCCATCCCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-899s21c1
Sequence:CCGGTTTAGTTGGAAATACCTTATGCTCGAGCATAAGGTATTTCCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-921s21c1
Sequence:CCGGTTGATTGCTGTTGGCTATTATCTCGAGATAATAGCCAACAGCAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-1190s21c1
Sequence:CCGGCAAATTCAAGGTGATATTAACCTCGAGGTTAATATCACCTTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026123.2-1097s1c1
Sequence:CCGGCTAGAGAAACTGTCTGGTGTTCTCGAGAACACCAGACAGTTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-809s1c1
Sequence:CCGGGCTCCTCGTCATTCTGCATTTCTCGAGAAATGCAGAATGACGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-422s1c1
Sequence:CCGGGCTCTTTCGATTTCGGCAGATCTCGAGATCTGCCGAAATCGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-345s1c1
Sequence:CCGGCACGGGAATGGAGTATTAAATCTCGAGATTTAATACTCCATTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-344s1c1
Sequence:CCGGGCACGGGAATGGAGTATTAAACTCGAGTTTAATACTCCATTCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026123
VALIDATED
UNC50 MISSION shRNA shRNA Plasmid DNA
unc-50 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-704s21c1
Sequence:CCGGCCTTCTGATCTCAACGTTAATCTCGAGATTAACGTTGAGATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-1045s21c1
Sequence:CCGGTGGCACTGGGATGGAACTTTACTCGAGTAAAGTTCCATCCCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-899s21c1
Sequence:CCGGTTTAGTTGGAAATACCTTATGCTCGAGCATAAGGTATTTCCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-921s21c1
Sequence:CCGGTTGATTGCTGTTGGCTATTATCTCGAGATAATAGCCAACAGCAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-1190s21c1
Sequence:CCGGCAAATTCAAGGTGATATTAACCTCGAGGTTAATATCACCTTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026123.2-1097s1c1
Sequence:CCGGCTAGAGAAACTGTCTGGTGTTCTCGAGAACACCAGACAGTTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-809s1c1
Sequence:CCGGGCTCCTCGTCATTCTGCATTTCTCGAGAAATGCAGAATGACGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-422s1c1
Sequence:CCGGGCTCTTTCGATTTCGGCAGATCTCGAGATCTGCCGAAATCGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-345s1c1
Sequence:CCGGCACGGGAATGGAGTATTAAATCTCGAGATTTAATACTCCATTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-344s1c1
Sequence:CCGGGCACGGGAATGGAGTATTAAACTCGAGTTTAATACTCCATTCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026123
VALIDATED
UNC50 MISSION shRNA Lentiviral Transduction Particles
unc-50 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-704s21c1
Sequence:CCGGCCTTCTGATCTCAACGTTAATCTCGAGATTAACGTTGAGATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-1045s21c1
Sequence:CCGGTGGCACTGGGATGGAACTTTACTCGAGTAAAGTTCCATCCCAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-899s21c1
Sequence:CCGGTTTAGTTGGAAATACCTTATGCTCGAGCATAAGGTATTTCCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-921s21c1
Sequence:CCGGTTGATTGCTGTTGGCTATTATCTCGAGATAATAGCCAACAGCAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026123.3-1190s21c1
Sequence:CCGGCAAATTCAAGGTGATATTAACCTCGAGGTTAATATCACCTTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026123.2-1097s1c1
Sequence:CCGGCTAGAGAAACTGTCTGGTGTTCTCGAGAACACCAGACAGTTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-809s1c1
Sequence:CCGGGCTCCTCGTCATTCTGCATTTCTCGAGAAATGCAGAATGACGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-422s1c1
Sequence:CCGGGCTCTTTCGATTTCGGCAGATCTCGAGATCTGCCGAAATCGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-345s1c1
Sequence:CCGGCACGGGAATGGAGTATTAAATCTCGAGATTTAATACTCCATTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026123.2-344s1c1
Sequence:CCGGGCACGGGAATGGAGTATTAAACTCGAGTTTAATACTCCATTCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014044
VALIDATED
UNC50 MISSION shRNA Bacterial Glycerol Stock
unc-50 homolog (C. elegans)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-749s21c1
Sequence:CCGGGGTTGCAGTTGGCTATTATATCTCGAGATATAATAGCCAACTGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-554s21c1
Sequence:CCGGGTTCATCTCTAACAAGTATTTCTCGAGAAATACTTGTTAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014044.5-970s21c1
Sequence:CCGGGTATTGTGAAGTGATCATTTCCTCGAGGAAATGATCACTTCACAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-467s21c1
Sequence:CCGGGGGATTCTTTGAGACAATAAACTCGAGTTTATTGTCTCAAAGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014044.4-1564s1c1
Sequence:CCGGGATAGCAACTTTAATGTGGTTCTCGAGAACCACATTAAAGTTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014044.4-1966s1c1
Sequence:CCGGGAGAAGAAGATTCAATCGTAACTCGAGTTACGATTGAATCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014044
VALIDATED
UNC50 MISSION shRNA shRNA Plasmid DNA
unc-50 homolog (C. elegans)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-749s21c1
Sequence:CCGGGGTTGCAGTTGGCTATTATATCTCGAGATATAATAGCCAACTGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-554s21c1
Sequence:CCGGGTTCATCTCTAACAAGTATTTCTCGAGAAATACTTGTTAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014044.5-970s21c1
Sequence:CCGGGTATTGTGAAGTGATCATTTCCTCGAGGAAATGATCACTTCACAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-467s21c1
Sequence:CCGGGGGATTCTTTGAGACAATAAACTCGAGTTTATTGTCTCAAAGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014044.4-1564s1c1
Sequence:CCGGGATAGCAACTTTAATGTGGTTCTCGAGAACCACATTAAAGTTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014044.4-1966s1c1
Sequence:CCGGGAGAAGAAGATTCAATCGTAACTCGAGTTACGATTGAATCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014044
VALIDATED
UNC50 MISSION shRNA Lentiviral Transduction Particles
unc-50 homolog (C. elegans)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-749s21c1
Sequence:CCGGGGTTGCAGTTGGCTATTATATCTCGAGATATAATAGCCAACTGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-554s21c1
Sequence:CCGGGTTCATCTCTAACAAGTATTTCTCGAGAAATACTTGTTAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014044.5-970s21c1
Sequence:CCGGGTATTGTGAAGTGATCATTTCCTCGAGGAAATGATCACTTCACAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014044.5-467s21c1
Sequence:CCGGGGGATTCTTTGAGACAATAAACTCGAGTTTATTGTCTCAAAGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014044.4-1564s1c1
Sequence:CCGGGATAGCAACTTTAATGTGGTTCTCGAGAACCACATTAAAGTTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014044.4-1966s1c1
Sequence:CCGGGAGAAGAAGATTCAATCGTAACTCGAGTTACGATTGAATCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks