EMAIL THIS PAGE TO A FRIEND

UNC5A

unc-5 homolog A (C. elegans)

Synonyms: UNC5H1
UniProtKB ID: Q6ZN44, B2RXE6, Q8TF26, Q96GP4
Gene ID:
Human(90249) Summary: UNC5A belongs to a family of netrin-1 (MIM 601614) receptors thought to mediate the chemorepulsive effect of netrin-1 on specific axons. For more information on UNC5 proteins, see UNC5C (MIM 603610).[supplied by OMIM, Apr 2004]
Mouse(107448) unc-5 homolog A (C. elegans)
Rat(60629) unc-5 homolog A (C. elegans)
Zebrafish(799734) unc-5 homolog A (C. elegans)
chicken(426419) unc-5 homolog A (C. elegans)
dog(489097) unc-5 homolog A (C. elegans)
domestic cat(101087901) unc-5 homolog A (C. elegans)
cow(506037) unc-5 homolog A (C. elegans)
sheep(101118946) unc-5 homolog A (C. elegans)
naked mole-rat(101705817) unc-5 homolog A (C. elegans)
domestic guinea pig(100732765) unc-5 homolog A (C. elegans)
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301875 Anti-UNC5A affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB2108252 Anti-UNC5A antibody produced in rabbit affinity isolated antibody human, zebrafish, mouse, horse, rabbit, rat, guinea pig
western blot pricing
HPA071450 Anti-UNC5A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

ELISA

Product # Description Species Add to Cart
 
RAB1932 Rat UNC5H1 ELISA for serum, plasma and cell culture supernatants rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133369 Rosetta Predictions human pricing
NM_022206 Rosetta Predictions rat pricing
NM_153131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177050 predicted 1032
2 SASI_Hs01_00177051 predicted 2256
3 SASI_Hs01_00177052 predicted 2730
4 SASI_Hs01_00177053 predicted 1047
5 SASI_Hs01_00177054 predicted 1542
6 SASI_Hs01_00177055 predicted 615
7 SASI_Hs01_00177056 predicted 487
8 SASI_Hs01_00177057 predicted 605
9 SASI_Hs01_00177058 predicted 1891
10 SASI_Hs02_00363061 predicted 2135
11 SASI_Hs01_00177059 predicted 2588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032294 predicted 1134
2 SASI_Rn01_00032295 predicted 1134
3 SASI_Rn01_00032296 predicted 298
4 SASI_Rn01_00032297 predicted 1991
5 SASI_Rn01_00032298 predicted 2365
6 SASI_Rn02_00262962 predicted 1582
7 SASI_Rn01_00032299 predicted 1069
8 SASI_Rn01_00032300 predicted 2023
9 SASI_Rn02_00262963 predicted 2366
10 SASI_Rn01_00032302 predicted 1581
11 SASI_Rn01_00032301 predicted 359
12 SASI_Rn01_00032303 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034451 predicted 1803
2 SASI_Mm01_00034452 predicted 382
3 SASI_Mm01_00034453 predicted 2221
4 SASI_Mm01_00034454 predicted 2559
5 SASI_Mm01_00034455 predicted 1364
6 SASI_Mm01_00034456 predicted 2589
7 SASI_Mm01_00034457 predicted 542
8 SASI_Mm01_00034458 predicted 1560
9 SASI_Mm01_00034459 predicted 519
10 SASI_Mm01_00034460 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133369
UNC5A MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog A (C. elegans)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-597s1c1
Sequence:CCGGCAAGAGTCAGAAGGCCTACATCTCGAGATGTAGGCCTTCTGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-621s1c1
Sequence:CCGGCATAGCCTATTTGCGCAAGAACTCGAGTTCTTGCGCAAATAGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-2343s1c1
Sequence:CCGGGCAGAGCTTCAGCATCAACTTCTCGAGAAGTTGATGCTGAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-1605s1c1
Sequence:CCGGCCGAGGGAAGATCTATGAGATCTCGAGATCTCATAGATCTTCCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-1164s1c1
Sequence:CCGGCCTCGTTTATTGCCGGAAGAACTCGAGTTCTTCCGGCAATAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-2179s1c1
Sequence:CCGGCTGTGGAAGAGTAAGCTCCTTCTCGAGAAGGAGCTTACTCTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-342s1c1
Sequence:CCGGCGAGGATGTGTACATCGTCAACTCGAGTTGACGATGTACACATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133369.2-1547s21c1
Sequence:CCGGGCCGGCTGATGATCCCTAATACTCGAGTATTAGGGATCATCAGCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133369.2-3115s21c1
Sequence:CCGGTGGACCTTATGCAAACATTTCCTCGAGGAAATGTTTGCATAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133369
UNC5A MISSION shRNA shRNA Plasmid DNA
unc-5 homolog A (C. elegans)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-597s1c1
Sequence:CCGGCAAGAGTCAGAAGGCCTACATCTCGAGATGTAGGCCTTCTGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-621s1c1
Sequence:CCGGCATAGCCTATTTGCGCAAGAACTCGAGTTCTTGCGCAAATAGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-2343s1c1
Sequence:CCGGGCAGAGCTTCAGCATCAACTTCTCGAGAAGTTGATGCTGAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-1605s1c1
Sequence:CCGGCCGAGGGAAGATCTATGAGATCTCGAGATCTCATAGATCTTCCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-1164s1c1
Sequence:CCGGCCTCGTTTATTGCCGGAAGAACTCGAGTTCTTCCGGCAATAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-2179s1c1
Sequence:CCGGCTGTGGAAGAGTAAGCTCCTTCTCGAGAAGGAGCTTACTCTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-342s1c1
Sequence:CCGGCGAGGATGTGTACATCGTCAACTCGAGTTGACGATGTACACATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133369.2-1547s21c1
Sequence:CCGGGCCGGCTGATGATCCCTAATACTCGAGTATTAGGGATCATCAGCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133369.2-3115s21c1
Sequence:CCGGTGGACCTTATGCAAACATTTCCTCGAGGAAATGTTTGCATAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133369
UNC5A MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog A (C. elegans)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-597s1c1
Sequence:CCGGCAAGAGTCAGAAGGCCTACATCTCGAGATGTAGGCCTTCTGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-621s1c1
Sequence:CCGGCATAGCCTATTTGCGCAAGAACTCGAGTTCTTGCGCAAATAGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-2343s1c1
Sequence:CCGGGCAGAGCTTCAGCATCAACTTCTCGAGAAGTTGATGCTGAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-1605s1c1
Sequence:CCGGCCGAGGGAAGATCTATGAGATCTCGAGATCTCATAGATCTTCCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-1164s1c1
Sequence:CCGGCCTCGTTTATTGCCGGAAGAACTCGAGTTCTTCCGGCAATAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-2179s1c1
Sequence:CCGGCTGTGGAAGAGTAAGCTCCTTCTCGAGAAGGAGCTTACTCTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133369.2-342s1c1
Sequence:CCGGCGAGGATGTGTACATCGTCAACTCGAGTTGACGATGTACACATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133369.2-1547s21c1
Sequence:CCGGGCCGGCTGATGATCCCTAATACTCGAGTATTAGGGATCATCAGCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133369.2-3115s21c1
Sequence:CCGGTGGACCTTATGCAAACATTTCCTCGAGGAAATGTTTGCATAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153131
UNC5A MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog A (C. elegans)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153131.1-3337s1c1
Sequence:CCGGGTGGGCCTTATGCAAACATTTCTCGAGAAATGTTTGCATAAGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2217s1c1
Sequence:CCGGCGAGTACAACATCCGAGTGTACTCGAGTACACTCGGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-719s1c1
Sequence:CCGGAGCAAGGCATTGTGCTACCTTCTCGAGAAGGTAGCACAATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2731s1c1
Sequence:CCGGCGAACTCTAGCCCAGAAACTTCTCGAGAAGTTTCTGGGCTAGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2551s1c1
Sequence:CCGGCAGAGCTTCAACATCAACTTTCTCGAGAAAGTTGATGTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-1566s21c1
Sequence:CCGGCCCAAGTTCCAGCTCTCTAATCTCGAGATTAGAGAGCTGGAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-2582s21c1
Sequence:CCGGGGACACGAGGTTTGCTGAAATCTCGAGATTTCAGCAAACCTCGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-539s21c1
Sequence:CCGGGGTCCGGATCAACGTATCAAGCTCGAGCTTGATACGTTGATCCGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153131
UNC5A MISSION shRNA shRNA Plasmid DNA
unc-5 homolog A (C. elegans)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153131.1-3337s1c1
Sequence:CCGGGTGGGCCTTATGCAAACATTTCTCGAGAAATGTTTGCATAAGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2217s1c1
Sequence:CCGGCGAGTACAACATCCGAGTGTACTCGAGTACACTCGGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-719s1c1
Sequence:CCGGAGCAAGGCATTGTGCTACCTTCTCGAGAAGGTAGCACAATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2731s1c1
Sequence:CCGGCGAACTCTAGCCCAGAAACTTCTCGAGAAGTTTCTGGGCTAGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2551s1c1
Sequence:CCGGCAGAGCTTCAACATCAACTTTCTCGAGAAAGTTGATGTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-1566s21c1
Sequence:CCGGCCCAAGTTCCAGCTCTCTAATCTCGAGATTAGAGAGCTGGAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-2582s21c1
Sequence:CCGGGGACACGAGGTTTGCTGAAATCTCGAGATTTCAGCAAACCTCGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-539s21c1
Sequence:CCGGGGTCCGGATCAACGTATCAAGCTCGAGCTTGATACGTTGATCCGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153131
UNC5A MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog A (C. elegans)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153131.1-3337s1c1
Sequence:CCGGGTGGGCCTTATGCAAACATTTCTCGAGAAATGTTTGCATAAGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2217s1c1
Sequence:CCGGCGAGTACAACATCCGAGTGTACTCGAGTACACTCGGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-719s1c1
Sequence:CCGGAGCAAGGCATTGTGCTACCTTCTCGAGAAGGTAGCACAATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2731s1c1
Sequence:CCGGCGAACTCTAGCCCAGAAACTTCTCGAGAAGTTTCTGGGCTAGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153131.1-2551s1c1
Sequence:CCGGCAGAGCTTCAACATCAACTTTCTCGAGAAAGTTGATGTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-1566s21c1
Sequence:CCGGCCCAAGTTCCAGCTCTCTAATCTCGAGATTAGAGAGCTGGAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-2582s21c1
Sequence:CCGGGGACACGAGGTTTGCTGAAATCTCGAGATTTCAGCAAACCTCGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153131.3-539s21c1
Sequence:CCGGGGTCCGGATCAACGTATCAAGCTCGAGCTTGATACGTTGATCCGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks