EMAIL THIS PAGE TO A FRIEND

UNC5B

unc-5 homolog B (C. elegans)

Synonyms: UNC5H2 p53RDL1
UniProtKB ID: Q8IZJ1, Q5T3R9, Q5T3S0, Q86SN3, Q8N1Y2, Q9H9F3
Gene ID:
Human(219699) Summary: This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(107449) unc-5 homolog B (C. elegans)
Rat(60630) unc-5 homolog B (C. elegans)
domestic guinea pig(100736131) unc-5 homolog B (C. elegans)
naked mole-rat(101720276) unc-5 homolog B (C. elegans)
cow(524942) unc-5 homolog B (C. elegans)
sheep(101107068) unc-5 homolog B (C. elegans)
Zebrafish(494130) unc-5 homolog B (C. elegans)
Horse(100072764) unc-5 homolog B (C. elegans)
domestic cat(101101167) unc-5 homolog B (C. elegans)
dog(479239) unc-5 homolog B (C. elegans)
chicken(423716) unc-5 homolog B (C. elegans)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1933 Rat Unc5h2 ELISA for serum, plasma and cell culture supernatants rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170744 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124361 MISSION® esiRNA esiRNA human UNC5B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170744 Rosetta Predictions human pricing
NM_022207 Rosetta Predictions rat pricing
NM_029770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034229 predicted 2456
2 SASI_Hs01_00034230 predicted 2854
3 SASI_Hs01_00034231 predicted 3061
4 SASI_Hs01_00034232 predicted 2127
5 SASI_Hs01_00034233 predicted 998
6 SASI_Hs01_00034234 predicted 2960
7 SASI_Hs01_00034235 predicted 762
8 SASI_Hs01_00034236 predicted 2158
9 SASI_Hs01_00034237 predicted 2438
10 SASI_Hs01_00034238 predicted 2159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087486 predicted 1717
2 SASI_Rn01_00087487 predicted 1143
3 SASI_Rn01_00087488 predicted 1443
4 SASI_Rn01_00087489 predicted 1063
5 SASI_Rn01_00087490 predicted 611
6 SASI_Rn01_00087491 predicted 829
7 SASI_Rn01_00087492 predicted 864
8 SASI_Rn01_00087493 predicted 1348
9 SASI_Rn01_00087494 predicted 235
10 SASI_Rn01_00087495 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020556 predicted 2139
2 SASI_Mm02_00335915 predicted 3211
3 SASI_Mm01_00020557 predicted 2788
4 SASI_Mm01_00020558 predicted 1001
5 SASI_Mm01_00020559 predicted 1432
6 SASI_Mm01_00020560 predicted 1005
7 SASI_Mm01_00020561 predicted 2137
8 SASI_Mm01_00020562 predicted 452
9 SASI_Mm01_00020563 predicted 1487
10 SASI_Mm01_00020565 predicted 1022
11 SASI_Mm01_00020564 predicted 2832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170744
UNC5B MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog B (C. elegans)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-2487s21c1
Sequence:CCGGTGTTCACGGGCGAGTCCTATTCTCGAGAATAGGACTCGCCCGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-2664s21c1
Sequence:CCGGAGGAGCCGAAACCGCTAATGTCTCGAGACATTAGCGGTTTCGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-996s21c1
Sequence:CCGGAGGTGGAATGGCTCAAGAATGCTCGAGCATTCTTGAGCCATTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1928s1c1
Sequence:CCGGCCTGGCACATACCCTAGCGATCTCGAGATCGCTAGGGTATGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1056s1c1
Sequence:CCGGTGTCGGACACTGCCAACTATACTCGAGTATAGTTGGCAGTGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-2996s1c1
Sequence:CCGGCAGAAGATATGCAACAGCCTACTCGAGTAGGCTGTTGCATATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-2137s1c1
Sequence:CCGGCTACGAGATGTATCTACTCATCTCGAGATGAGTAGATACATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1674s1c1
Sequence:CCGGCCGTCAACTTTAAGACGGCAACTCGAGTTGCCGTCTTAAAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170744
UNC5B MISSION shRNA shRNA Plasmid DNA
unc-5 homolog B (C. elegans)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-2487s21c1
Sequence:CCGGTGTTCACGGGCGAGTCCTATTCTCGAGAATAGGACTCGCCCGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-2664s21c1
Sequence:CCGGAGGAGCCGAAACCGCTAATGTCTCGAGACATTAGCGGTTTCGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-996s21c1
Sequence:CCGGAGGTGGAATGGCTCAAGAATGCTCGAGCATTCTTGAGCCATTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1928s1c1
Sequence:CCGGCCTGGCACATACCCTAGCGATCTCGAGATCGCTAGGGTATGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1056s1c1
Sequence:CCGGTGTCGGACACTGCCAACTATACTCGAGTATAGTTGGCAGTGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-2996s1c1
Sequence:CCGGCAGAAGATATGCAACAGCCTACTCGAGTAGGCTGTTGCATATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-2137s1c1
Sequence:CCGGCTACGAGATGTATCTACTCATCTCGAGATGAGTAGATACATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1674s1c1
Sequence:CCGGCCGTCAACTTTAAGACGGCAACTCGAGTTGCCGTCTTAAAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170744
UNC5B MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog B (C. elegans)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-2487s21c1
Sequence:CCGGTGTTCACGGGCGAGTCCTATTCTCGAGAATAGGACTCGCCCGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-2664s21c1
Sequence:CCGGAGGAGCCGAAACCGCTAATGTCTCGAGACATTAGCGGTTTCGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170744.3-996s21c1
Sequence:CCGGAGGTGGAATGGCTCAAGAATGCTCGAGCATTCTTGAGCCATTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1928s1c1
Sequence:CCGGCCTGGCACATACCCTAGCGATCTCGAGATCGCTAGGGTATGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1056s1c1
Sequence:CCGGTGTCGGACACTGCCAACTATACTCGAGTATAGTTGGCAGTGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-2996s1c1
Sequence:CCGGCAGAAGATATGCAACAGCCTACTCGAGTAGGCTGTTGCATATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-2137s1c1
Sequence:CCGGCTACGAGATGTATCTACTCATCTCGAGATGAGTAGATACATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170744.2-1674s1c1
Sequence:CCGGCCGTCAACTTTAAGACGGCAACTCGAGTTGCCGTCTTAAAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029770
UNC5B MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-3092s1c1
Sequence:CCGGCCTAAACTACTTCGCCACCAACTCGAGTTGGTGGCGAAGTAGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-2444s1c1
Sequence:CCGGGCTGGGTTCCTACGTATTCATCTCGAGATGAATACGTAGGAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-2160s1c1
Sequence:CCGGCTACATATCAACAAGGCCGAACTCGAGTTCGGCCTTGTTGATATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-1128s1c1
Sequence:CCGGGCGGCCACAGTCATCGTCTATCTCGAGATAGACGATGACTGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-584s1c1
Sequence:CCGGCGCCTACATCGTAAAGAACAACTCGAGTTGTTCTTTACGATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029770
UNC5B MISSION shRNA shRNA Plasmid DNA
unc-5 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-3092s1c1
Sequence:CCGGCCTAAACTACTTCGCCACCAACTCGAGTTGGTGGCGAAGTAGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-2444s1c1
Sequence:CCGGGCTGGGTTCCTACGTATTCATCTCGAGATGAATACGTAGGAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-2160s1c1
Sequence:CCGGCTACATATCAACAAGGCCGAACTCGAGTTCGGCCTTGTTGATATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-1128s1c1
Sequence:CCGGGCGGCCACAGTCATCGTCTATCTCGAGATAGACGATGACTGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-584s1c1
Sequence:CCGGCGCCTACATCGTAAAGAACAACTCGAGTTGTTCTTTACGATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029770
UNC5B MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-3092s1c1
Sequence:CCGGCCTAAACTACTTCGCCACCAACTCGAGTTGGTGGCGAAGTAGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-2444s1c1
Sequence:CCGGGCTGGGTTCCTACGTATTCATCTCGAGATGAATACGTAGGAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-2160s1c1
Sequence:CCGGCTACATATCAACAAGGCCGAACTCGAGTTCGGCCTTGTTGATATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-1128s1c1
Sequence:CCGGGCGGCCACAGTCATCGTCTATCTCGAGATAGACGATGACTGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029770.1-584s1c1
Sequence:CCGGCGCCTACATCGTAAAGAACAACTCGAGTTGTTCTTTACGATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks