EMAIL THIS PAGE TO A FRIEND

UNC5C

unc-5 homolog C (C. elegans)

Synonyms: UNC5H3
UniProtKB ID: O95185, Q8IUT0
Gene ID:
Human(8633) Summary: This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
Mouse(22253) unc-5 homolog C (C. elegans)
Rat(362049) unc-5 homolog C (C. elegans)
Zebrafish(557316) unc-5 homolog C (C. elegans)
chicken(395101) unc-5 homolog C (C. elegans)
dog(478485) unc-5 homolog C (C. elegans)
Horse(100065541) unc-5 homolog C (C. elegans)
domestic cat(101081887) unc-5 homolog C (C. elegans)
cow(533256) unc-5 homolog C (C. elegans)
sheep(101113935) unc-5 homolog C (C. elegans)
naked mole-rat(101709609) unc-5 homolog C (C. elegans)
Domestic Rabbit(100351024) unc-5 homolog C (C. elegans)
domestic guinea pig(100732395) unc-5 homolog C (C. elegans)
Gene Class: Apoptosis
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003728 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051711 MISSION® esiRNA esiRNA human UNC5C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003728 Rosetta Predictions human pricing
NM_199407 Rosetta Predictions rat pricing
NM_009472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130132 predicted 1287
2 SASI_Hs01_00130134 predicted 770
3 SASI_Hs01_00130135 predicted 3036
4 SASI_Hs01_00130136 predicted 1655
5 SASI_Hs01_00130137 predicted 1443
6 SASI_Hs02_00336174 predicted 1272
7 SASI_Hs01_00130138 predicted 2249
8 SASI_Hs01_00130139 predicted 2330
9 SASI_Hs01_00130140 predicted 624
10 SASI_Hs02_00336175 predicted 1729
11 SASI_Hs01_00130131 predicted 2418
12 SASI_Hs01_00130133 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076639 predicted 2409
2 SASI_Rn01_00076640 predicted 1437
3 SASI_Rn01_00076641 predicted 1307
4 SASI_Rn01_00076642 predicted 2240
5 SASI_Rn01_00076643 predicted 1421
6 SASI_Rn01_00076644 predicted 1837
7 SASI_Rn01_00076645 predicted 1543
8 SASI_Rn01_00076647 predicted 509
9 SASI_Rn01_00076648 predicted 2718
10 SASI_Rn02_00270235 predicted 326
11 SASI_Rn01_00076646 predicted 2785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078791 predicted 1270
2 SASI_Mm01_00078792 predicted 478
3 SASI_Mm01_00078793 predicted 2498
4 SASI_Mm01_00078794 predicted 1360
5 SASI_Mm01_00078795 predicted 1292
6 SASI_Mm02_00316198 predicted 470
7 SASI_Mm01_00078798 predicted 1394
8 SASI_Mm01_00078799 predicted 513
9 SASI_Mm01_00078800 predicted 2374
10 SASI_Mm02_00316199 predicted 1839
11 SASI_Mm01_00078796 predicted 673
12 SASI_Mm01_00078797 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009472
VALIDATED
UNC5C MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog C (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-778s1c1
Sequence:CCGGCCTGCTGAAGATCGGAACTTTCTCGAGAAAGTTCCGATCTTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009472.1-265s1c1
Sequence:CCGGGCCGCTCAAGATGATGAATTTCTCGAGAAATTCATCATCTTGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009472.1-2191s1c1
Sequence:CCGGCGTCTTAAACTGGCCATCTTTCTCGAGAAAGATGGCCAGTTTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-1540s1c1
Sequence:CCGGCCAATGACCAACTCTCCAATTCTCGAGAATTGGAGAGTTGGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-2421s1c1
Sequence:CCGGGCTGGCTAAGTATCAGGAAATCTCGAGATTTCCTGATACTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-3337s21c1
Sequence:CCGGCTGTCCATGGCTCGTTCTATTCTCGAGAATAGAACGAGCCATGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-905s21c1
Sequence:CCGGCAGCCACTGTCATCGTGTATGCTCGAGCATACACGATGACAGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-485s21c1
Sequence:CCGGATGAAACCTCTGGTCTAATTGCTCGAGCAATTAGACCAGAGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-2805s21c1
Sequence:CCGGATCGAGCCCAACTGGCGTAATCTCGAGATTACGCCAGTTGGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-1678s21c1
Sequence:CCGGCTAGAGAATGAGGCCCTTAACCTCGAGGTTAAGGGCCTCATTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009472
VALIDATED
UNC5C MISSION shRNA shRNA Plasmid DNA
unc-5 homolog C (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-778s1c1
Sequence:CCGGCCTGCTGAAGATCGGAACTTTCTCGAGAAAGTTCCGATCTTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009472.1-265s1c1
Sequence:CCGGGCCGCTCAAGATGATGAATTTCTCGAGAAATTCATCATCTTGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009472.1-2191s1c1
Sequence:CCGGCGTCTTAAACTGGCCATCTTTCTCGAGAAAGATGGCCAGTTTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-1540s1c1
Sequence:CCGGCCAATGACCAACTCTCCAATTCTCGAGAATTGGAGAGTTGGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-2421s1c1
Sequence:CCGGGCTGGCTAAGTATCAGGAAATCTCGAGATTTCCTGATACTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-3337s21c1
Sequence:CCGGCTGTCCATGGCTCGTTCTATTCTCGAGAATAGAACGAGCCATGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-905s21c1
Sequence:CCGGCAGCCACTGTCATCGTGTATGCTCGAGCATACACGATGACAGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-485s21c1
Sequence:CCGGATGAAACCTCTGGTCTAATTGCTCGAGCAATTAGACCAGAGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-2805s21c1
Sequence:CCGGATCGAGCCCAACTGGCGTAATCTCGAGATTACGCCAGTTGGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-1678s21c1
Sequence:CCGGCTAGAGAATGAGGCCCTTAACCTCGAGGTTAAGGGCCTCATTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009472
VALIDATED
UNC5C MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog C (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-778s1c1
Sequence:CCGGCCTGCTGAAGATCGGAACTTTCTCGAGAAAGTTCCGATCTTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009472.1-265s1c1
Sequence:CCGGGCCGCTCAAGATGATGAATTTCTCGAGAAATTCATCATCTTGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009472.1-2191s1c1
Sequence:CCGGCGTCTTAAACTGGCCATCTTTCTCGAGAAAGATGGCCAGTTTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-1540s1c1
Sequence:CCGGCCAATGACCAACTCTCCAATTCTCGAGAATTGGAGAGTTGGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009472.1-2421s1c1
Sequence:CCGGGCTGGCTAAGTATCAGGAAATCTCGAGATTTCCTGATACTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-3337s21c1
Sequence:CCGGCTGTCCATGGCTCGTTCTATTCTCGAGAATAGAACGAGCCATGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-905s21c1
Sequence:CCGGCAGCCACTGTCATCGTGTATGCTCGAGCATACACGATGACAGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-485s21c1
Sequence:CCGGATGAAACCTCTGGTCTAATTGCTCGAGCAATTAGACCAGAGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-2805s21c1
Sequence:CCGGATCGAGCCCAACTGGCGTAATCTCGAGATTACGCCAGTTGGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009472.3-1678s21c1
Sequence:CCGGCTAGAGAATGAGGCCCTTAACCTCGAGGTTAAGGGCCTCATTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003728
UNC5C MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog C (C. elegans)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-2377s1c1
Sequence:CCGGGCGCCTGTCAATTCACGATATCTCGAGATATCGTGAATTGACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-2425s1c1
Sequence:CCGGGCTGGCTAAATATCAGGAAATCTCGAGATTTCCTGATATTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-634s1c1
Sequence:CCGGGCGCATTGCATATCTACGGAACTCGAGTTCCGTAGATATGCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-386s1c1
Sequence:CCGGCCTGTGAACCTGTACTGTAAACTCGAGTTTACAGTACAGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-1361s1c1
Sequence:CCGGCGGAAGAATCATCGTGACTTTCTCGAGAAAGTCACGATGATTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-2821s21c1
Sequence:CCGGTGGCGTAATCCTGGATCTTTGCTCGAGCAAAGATCCAGGATTACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-814s21c1
Sequence:CCGGTGATCACAACCTCATCATAAACTCGAGTTTATGATGAGGTTGTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-1733s21c1
Sequence:CCGGGATCCATCCTGTACCGCATTTCTCGAGAAATGCGGTACAGGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003728
UNC5C MISSION shRNA shRNA Plasmid DNA
unc-5 homolog C (C. elegans)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-2377s1c1
Sequence:CCGGGCGCCTGTCAATTCACGATATCTCGAGATATCGTGAATTGACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-2425s1c1
Sequence:CCGGGCTGGCTAAATATCAGGAAATCTCGAGATTTCCTGATATTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-634s1c1
Sequence:CCGGGCGCATTGCATATCTACGGAACTCGAGTTCCGTAGATATGCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-386s1c1
Sequence:CCGGCCTGTGAACCTGTACTGTAAACTCGAGTTTACAGTACAGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-1361s1c1
Sequence:CCGGCGGAAGAATCATCGTGACTTTCTCGAGAAAGTCACGATGATTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-2821s21c1
Sequence:CCGGTGGCGTAATCCTGGATCTTTGCTCGAGCAAAGATCCAGGATTACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-814s21c1
Sequence:CCGGTGATCACAACCTCATCATAAACTCGAGTTTATGATGAGGTTGTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-1733s21c1
Sequence:CCGGGATCCATCCTGTACCGCATTTCTCGAGAAATGCGGTACAGGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003728
UNC5C MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog C (C. elegans)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-2377s1c1
Sequence:CCGGGCGCCTGTCAATTCACGATATCTCGAGATATCGTGAATTGACAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-2425s1c1
Sequence:CCGGGCTGGCTAAATATCAGGAAATCTCGAGATTTCCTGATATTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-634s1c1
Sequence:CCGGGCGCATTGCATATCTACGGAACTCGAGTTCCGTAGATATGCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-386s1c1
Sequence:CCGGCCTGTGAACCTGTACTGTAAACTCGAGTTTACAGTACAGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003728.2-1361s1c1
Sequence:CCGGCGGAAGAATCATCGTGACTTTCTCGAGAAAGTCACGATGATTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-2821s21c1
Sequence:CCGGTGGCGTAATCCTGGATCTTTGCTCGAGCAAAGATCCAGGATTACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-814s21c1
Sequence:CCGGTGATCACAACCTCATCATAAACTCGAGTTTATGATGAGGTTGTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003728.2-1733s21c1
Sequence:CCGGGATCCATCCTGTACCGCATTTCTCGAGAAATGCGGTACAGGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks