EMAIL THIS PAGE TO A FRIEND

UNC5CL

unc-5 homolog C (C. elegans)-like

Synonyms: MUXA ZUD
UniProtKB ID: Q8IV45, Q5TGU1
Gene ID:
Mouse(76589) unc-5 homolog C (C. elegans)-like
Rat(301225) unc-5 homolog C (C. elegans)-like
domestic guinea pig(100719059) unc-5 homolog C (C. elegans)-like
Domestic Rabbit(100339652) unc-5 homolog C (C. elegans)-like
naked mole-rat(101721341) unc-5 homolog C (C. elegans)-like
cow(615134) unc-5 homolog C (C. elegans)-like
sheep(101107479) unc-5 homolog C (C. elegans)-like
Horse(100066002) unc-5 homolog C (C. elegans)-like
domestic cat(101097396) unc-5 homolog C (C. elegans)-like
dog(481786) unc-5 homolog C (C. elegans)-like
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173561 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173561 Rosetta Predictions human pricing
NM_001106882 Rosetta Predictions rat pricing
NM_152823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181041 predicted 2081
2 SASI_Hs01_00181042 predicted 1346
3 SASI_Hs02_00368385 predicted 1153
4 SASI_Hs01_00181043 predicted 1213
5 SASI_Hs01_00181044 predicted 1036
6 SASI_Hs01_00181045 predicted 2072
7 SASI_Hs02_00368386 predicted 1329
8 SASI_Hs01_00181047 predicted 313
9 SASI_Hs01_00181048 predicted 1410
10 SASI_Hs01_00181049 predicted 2015
11 SASI_Hs01_00181046 predicted 891
12 SASI_Hs01_00181050 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223336 predicted 1287
2 SASI_Rn02_00223337 predicted 1190
3 SASI_Rn02_00223338 predicted 295
4 SASI_Rn02_00223339 predicted 1074
5 SASI_Rn02_00223340 predicted 1234
6 SASI_Rn02_00223341 predicted 752
7 SASI_Rn02_00223342 predicted 578
8 SASI_Rn02_00223343 predicted 1107
9 SASI_Rn02_00223344 predicted 1221
10 SASI_Rn02_00223345 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200240 predicted 1062
2 SASI_Mm01_00200241 predicted 770
3 SASI_Mm01_00200242 predicted 1715
4 SASI_Mm01_00200243 predicted 1177
5 SASI_Mm01_00200244 predicted 571
6 SASI_Mm01_00200245 predicted 343
7 SASI_Mm01_00200246 predicted 642
8 SASI_Mm01_00200248 predicted 742
9 SASI_Mm01_00200249 predicted 1163
10 SASI_Mm02_00342831 predicted 1233
11 SASI_Mm01_00200247 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173561
UNC5CL MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog C (C. elegans)-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173561.1-2077s21c1
Sequence:CCGGGGAGTCAAGATGTGCTCATAGCTCGAGCTATGAGCACATCTTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173561.1-1689s21c1
Sequence:CCGGGGTTGTTCTCCTACGCCTAAGCTCGAGCTTAGGCGTAGGAGAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173561.1-1010s21c1
Sequence:CCGGGTGCCTGAAGCTCACGTACATCTCGAGATGTACGTGAGCTTCAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-1141s1c1
Sequence:CCGGCCGATGAGAATGAGGACTGTTCTCGAGAACAGTCCTCATTCTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-878s1c1
Sequence:CCGGGCAACTGCGTATCTACTTCCTCTCGAGAGGAAGTAGATACGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-377s1c1
Sequence:CCGGGATGCACAAACTGTTGGTGTTCTCGAGAACACCAACAGTTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173561.1-2680s1c1
Sequence:CCGGCCCTGTCTTTGTGTGTTTCTTCTCGAGAAGAAACACACAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-1219s1c1
Sequence:CCGGCCAAGTATATGGAAATCCTCACTCGAGTGAGGATTTCCATATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173561.1-2681s1c1
Sequence:CCGGCCTGTCTTTGTGTGTTTCTTTCTCGAGAAAGAAACACACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173561
UNC5CL MISSION shRNA shRNA Plasmid DNA
unc-5 homolog C (C. elegans)-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173561.1-2077s21c1
Sequence:CCGGGGAGTCAAGATGTGCTCATAGCTCGAGCTATGAGCACATCTTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173561.1-1689s21c1
Sequence:CCGGGGTTGTTCTCCTACGCCTAAGCTCGAGCTTAGGCGTAGGAGAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173561.1-1010s21c1
Sequence:CCGGGTGCCTGAAGCTCACGTACATCTCGAGATGTACGTGAGCTTCAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-1141s1c1
Sequence:CCGGCCGATGAGAATGAGGACTGTTCTCGAGAACAGTCCTCATTCTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-878s1c1
Sequence:CCGGGCAACTGCGTATCTACTTCCTCTCGAGAGGAAGTAGATACGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-377s1c1
Sequence:CCGGGATGCACAAACTGTTGGTGTTCTCGAGAACACCAACAGTTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173561.1-2680s1c1
Sequence:CCGGCCCTGTCTTTGTGTGTTTCTTCTCGAGAAGAAACACACAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-1219s1c1
Sequence:CCGGCCAAGTATATGGAAATCCTCACTCGAGTGAGGATTTCCATATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173561.1-2681s1c1
Sequence:CCGGCCTGTCTTTGTGTGTTTCTTTCTCGAGAAAGAAACACACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173561
UNC5CL MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog C (C. elegans)-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173561.1-2077s21c1
Sequence:CCGGGGAGTCAAGATGTGCTCATAGCTCGAGCTATGAGCACATCTTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173561.1-1689s21c1
Sequence:CCGGGGTTGTTCTCCTACGCCTAAGCTCGAGCTTAGGCGTAGGAGAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173561.1-1010s21c1
Sequence:CCGGGTGCCTGAAGCTCACGTACATCTCGAGATGTACGTGAGCTTCAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-1141s1c1
Sequence:CCGGCCGATGAGAATGAGGACTGTTCTCGAGAACAGTCCTCATTCTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-878s1c1
Sequence:CCGGGCAACTGCGTATCTACTTCCTCTCGAGAGGAAGTAGATACGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-377s1c1
Sequence:CCGGGATGCACAAACTGTTGGTGTTCTCGAGAACACCAACAGTTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173561.1-2680s1c1
Sequence:CCGGCCCTGTCTTTGTGTGTTTCTTCTCGAGAAGAAACACACAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173561.1-1219s1c1
Sequence:CCGGCCAAGTATATGGAAATCCTCACTCGAGTGAGGATTTCCATATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173561.1-2681s1c1
Sequence:CCGGCCTGTCTTTGTGTGTTTCTTTCTCGAGAAAGAAACACACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152823
UNC5CL MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog C (C. elegans)-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.3-1187s1c1
Sequence:CCGGCATTAACCAATGAGATCATTGCTCGAGCAATGATCTCATTGGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-1236s21c1
Sequence:CCGGGGAAACCAAATACGTTGAAATCTCGAGATTTCAACGTATTTGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-278s21c1
Sequence:CCGGCCACTCCATTACCAGAGTATGCTCGAGCATACTCTGGTAATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-1173s21c1
Sequence:CCGGTGAAGAGTGCTCGGCATTAACCTCGAGGTTAATGCCGAGCACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-387s21c1
Sequence:CCGGCACCCGCCAGATGATGCATAACTCGAGTTATGCATCATCTGGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152823.3-2052s21c1
Sequence:CCGGTTGGAGTCTGTTCTGCGAAATCTCGAGATTTCGCAGAACAGACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-288s1c1
Sequence:CCGGGATGCATAAGCTACTGGTGTTCTCGAGAACACCAGTAGCTTATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-1368s1c1
Sequence:CCGGCATTCTGGAATTGTTCGAGGACTCGAGTCCTCGAACAATTCCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-572s1c1
Sequence:CCGGCATGTGCCTACAGCAGCAATACTCGAGTATTGCTGCTGTAGGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152823
UNC5CL MISSION shRNA shRNA Plasmid DNA
unc-5 homolog C (C. elegans)-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.3-1187s1c1
Sequence:CCGGCATTAACCAATGAGATCATTGCTCGAGCAATGATCTCATTGGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-1236s21c1
Sequence:CCGGGGAAACCAAATACGTTGAAATCTCGAGATTTCAACGTATTTGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-278s21c1
Sequence:CCGGCCACTCCATTACCAGAGTATGCTCGAGCATACTCTGGTAATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-1173s21c1
Sequence:CCGGTGAAGAGTGCTCGGCATTAACCTCGAGGTTAATGCCGAGCACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-387s21c1
Sequence:CCGGCACCCGCCAGATGATGCATAACTCGAGTTATGCATCATCTGGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152823.3-2052s21c1
Sequence:CCGGTTGGAGTCTGTTCTGCGAAATCTCGAGATTTCGCAGAACAGACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-288s1c1
Sequence:CCGGGATGCATAAGCTACTGGTGTTCTCGAGAACACCAGTAGCTTATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-1368s1c1
Sequence:CCGGCATTCTGGAATTGTTCGAGGACTCGAGTCCTCGAACAATTCCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-572s1c1
Sequence:CCGGCATGTGCCTACAGCAGCAATACTCGAGTATTGCTGCTGTAGGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152823
UNC5CL MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog C (C. elegans)-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.3-1187s1c1
Sequence:CCGGCATTAACCAATGAGATCATTGCTCGAGCAATGATCTCATTGGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-1236s21c1
Sequence:CCGGGGAAACCAAATACGTTGAAATCTCGAGATTTCAACGTATTTGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-278s21c1
Sequence:CCGGCCACTCCATTACCAGAGTATGCTCGAGCATACTCTGGTAATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-1173s21c1
Sequence:CCGGTGAAGAGTGCTCGGCATTAACCTCGAGGTTAATGCCGAGCACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152823.3-387s21c1
Sequence:CCGGCACCCGCCAGATGATGCATAACTCGAGTTATGCATCATCTGGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152823.3-2052s21c1
Sequence:CCGGTTGGAGTCTGTTCTGCGAAATCTCGAGATTTCGCAGAACAGACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-288s1c1
Sequence:CCGGGATGCATAAGCTACTGGTGTTCTCGAGAACACCAGTAGCTTATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-1368s1c1
Sequence:CCGGCATTCTGGAATTGTTCGAGGACTCGAGTCCTCGAACAATTCCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152823.2-572s1c1
Sequence:CCGGCATGTGCCTACAGCAGCAATACTCGAGTATTGCTGCTGTAGGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks