EMAIL THIS PAGE TO A FRIEND

UNC5D

unc-5 homolog D (C. elegans)

Synonyms: PRO34692 Unc5h4
UniProtKB ID: Q6UXZ4, Q8WYP7
Gene ID:
Mouse(210801) unc-5 homolog D (C. elegans)
Rat(306534) unc-5 homolog D (C. elegans)
Zebrafish(100534686) unc-5 homolog D (C. elegans)
Horse(100058060) unc-5 homolog D (C. elegans)
domestic cat(101101462) unc-5 homolog D (C. elegans)
chicken(426920) unc-5 homolog D (C. elegans)
dog(482857) unc-5 homolog D (C. elegans)
cow(520004) unc-5 homolog D (C. elegans)
sheep(101109148) unc-5 homolog D (C. elegans)
naked mole-rat(101716656) unc-5 homolog D (C. elegans)
Domestic Rabbit(100339802) unc-5 homolog D (C. elegans)
domestic guinea pig(100730872) unc-5 homolog D (C. elegans)
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1771 Human UNC5H4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080872 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049311 MISSION® esiRNA esiRNA human UNC5D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080872 Rosetta Predictions human pricing
NM_001107319 Rosetta Predictions rat pricing
NM_153135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362667 predicted 1253
2 SASI_Hs01_00065988 predicted 1756
3 SASI_Hs01_00065989 predicted 2129
4 SASI_Hs01_00065990 predicted 354
5 SASI_Hs01_00065991 predicted 2992
6 SASI_Hs01_00065993 predicted 551
7 SASI_Hs02_00362668 predicted 1071
8 SASI_Hs01_00065994 predicted 2142
9 SASI_Hs01_00065995 predicted 2265
10 SASI_Hs01_00065996 predicted 2286
11 SASI_Hs01_00065987 predicted 286
12 SASI_Hs01_00065992 predicted 1705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227665 predicted 2669
2 SASI_Rn02_00227666 predicted 1924
3 SASI_Rn02_00227667 predicted 493
4 SASI_Rn02_00227668 predicted 1876
5 SASI_Rn02_00227669 predicted 2011
6 SASI_Rn02_00227670 predicted 2436
7 SASI_Rn02_00227671 predicted 1895
8 SASI_Rn02_00227672 predicted 623
9 SASI_Rn02_00227673 predicted 2572
10 SASI_Rn02_00227674 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056917 predicted 2024
2 SASI_Mm01_00056918 predicted 2949
3 SASI_Mm01_00056919 predicted 1024
4 SASI_Mm01_00056921 predicted 407
5 SASI_Mm01_00056922 predicted 2407
6 SASI_Mm01_00056923 predicted 2416
7 SASI_Mm01_00056924 predicted 2274
8 SASI_Mm01_00056925 predicted 1964
9 SASI_Mm01_00056926 predicted 2962
10 SASI_Mm02_00343005 predicted 919
11 SASI_Mm01_00056920 predicted 3123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153135
UNC5D MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog D (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-2195s1c1
Sequence:CCGGGCACTGGAACATTCACCTGAACTCGAGTTCAGGTGAATGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-1966s1c1
Sequence:CCGGGACGCTTAGTAATGCCAAATACTCGAGTATTTGGCATTACTAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-2951s1c1
Sequence:CCGGGAACAGCATCAATAGGAATTTCTCGAGAAATTCCTATTGATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-1854s1c1
Sequence:CCGGCGCGGATTCAGTACAATACATCTCGAGATGTATTGTACTGAATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-959s1c1
Sequence:CCGGGCTGTCAGACTCAGGGAATTACTCGAGTAATTCCCTGAGTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153135
UNC5D MISSION shRNA shRNA Plasmid DNA
unc-5 homolog D (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-2195s1c1
Sequence:CCGGGCACTGGAACATTCACCTGAACTCGAGTTCAGGTGAATGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-1966s1c1
Sequence:CCGGGACGCTTAGTAATGCCAAATACTCGAGTATTTGGCATTACTAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-2951s1c1
Sequence:CCGGGAACAGCATCAATAGGAATTTCTCGAGAAATTCCTATTGATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-1854s1c1
Sequence:CCGGCGCGGATTCAGTACAATACATCTCGAGATGTATTGTACTGAATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-959s1c1
Sequence:CCGGGCTGTCAGACTCAGGGAATTACTCGAGTAATTCCCTGAGTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153135
UNC5D MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog D (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-2195s1c1
Sequence:CCGGGCACTGGAACATTCACCTGAACTCGAGTTCAGGTGAATGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-1966s1c1
Sequence:CCGGGACGCTTAGTAATGCCAAATACTCGAGTATTTGGCATTACTAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-2951s1c1
Sequence:CCGGGAACAGCATCAATAGGAATTTCTCGAGAAATTCCTATTGATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-1854s1c1
Sequence:CCGGCGCGGATTCAGTACAATACATCTCGAGATGTATTGTACTGAATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153135.1-959s1c1
Sequence:CCGGGCTGTCAGACTCAGGGAATTACTCGAGTAATTCCCTGAGTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080872
UNC5D MISSION shRNA Bacterial Glycerol Stock
unc-5 homolog D (C. elegans)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-2825s1c1
Sequence:CCGGCACACGAAACTCTCAAACATTCTCGAGAATGTTTGAGAGTTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-497s1c1
Sequence:CCGGCGCATAGCCTATTTACGGAAACTCGAGTTTCCGTAAATAGGCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-1062s1c1
Sequence:CCGGGCAAATTCTGTGAAGGTCTAACTCGAGTTAGACCTTCACAGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-2320s1c1
Sequence:CCGGCCTCTGGAGAATTAAACCATTCTCGAGAATGGTTTAATTCTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-374s1c1
Sequence:CCGGCGCGAAGTGTTCATCAATGTTCTCGAGAACATTGATGAACACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080872.2-1554s21c1
Sequence:CCGGACTATGGCGTGGACGTCATTGCTCGAGCAATGACGTCCACGCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080872.2-3384s21c1
Sequence:CCGGATATAAGAGGGCTCTACTATCCTCGAGGATAGTAGAGCCCTCTTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080872
UNC5D MISSION shRNA shRNA Plasmid DNA
unc-5 homolog D (C. elegans)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-2825s1c1
Sequence:CCGGCACACGAAACTCTCAAACATTCTCGAGAATGTTTGAGAGTTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-497s1c1
Sequence:CCGGCGCATAGCCTATTTACGGAAACTCGAGTTTCCGTAAATAGGCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-1062s1c1
Sequence:CCGGGCAAATTCTGTGAAGGTCTAACTCGAGTTAGACCTTCACAGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-2320s1c1
Sequence:CCGGCCTCTGGAGAATTAAACCATTCTCGAGAATGGTTTAATTCTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-374s1c1
Sequence:CCGGCGCGAAGTGTTCATCAATGTTCTCGAGAACATTGATGAACACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080872.2-1554s21c1
Sequence:CCGGACTATGGCGTGGACGTCATTGCTCGAGCAATGACGTCCACGCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080872.2-3384s21c1
Sequence:CCGGATATAAGAGGGCTCTACTATCCTCGAGGATAGTAGAGCCCTCTTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080872
UNC5D MISSION shRNA Lentiviral Transduction Particles
unc-5 homolog D (C. elegans)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-2825s1c1
Sequence:CCGGCACACGAAACTCTCAAACATTCTCGAGAATGTTTGAGAGTTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-497s1c1
Sequence:CCGGCGCATAGCCTATTTACGGAAACTCGAGTTTCCGTAAATAGGCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-1062s1c1
Sequence:CCGGGCAAATTCTGTGAAGGTCTAACTCGAGTTAGACCTTCACAGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-2320s1c1
Sequence:CCGGCCTCTGGAGAATTAAACCATTCTCGAGAATGGTTTAATTCTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080872.1-374s1c1
Sequence:CCGGCGCGAAGTGTTCATCAATGTTCTCGAGAACATTGATGAACACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080872.2-1554s21c1
Sequence:CCGGACTATGGCGTGGACGTCATTGCTCGAGCAATGACGTCCACGCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080872.2-3384s21c1
Sequence:CCGGATATAAGAGGGCTCTACTATCCTCGAGGATAGTAGAGCCCTCTTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks