EMAIL THIS PAGE TO A FRIEND

UNC79

unc-79 homolog (C. elegans)

Synonyms: KIAA1409
UniProtKB ID: Q9P2D8, Q6ZUT7
Gene ID:
Mouse(217843) unc-79 homolog (C. elegans)
Rat(314401) unc-79 homolog (C. elegans)
fruit fly(42310) CG5237 gene product from transcript CG5237-RB
domestic cat(101100221) unc-79 homolog (C. elegans)
dog(612347) unc-79 homolog (C. elegans)
chicken(423426) unc-79 homolog (C. elegans)
domestic guinea pig(100736075) unc-79 homolog (C. elegans)
naked mole-rat(101703652) unc-79 homolog (C. elegans)
cow(537528) unc-79 homolog (C. elegans)
sheep(101116179) unc-79 homolog (C. elegans)
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020818 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020818 Rosetta Predictions human pricing
XM_001067752 Rosetta Predictions rat pricing
XM_234477 Rosetta Predictions rat pricing
NM_001081017 Rosetta Predictions mouse pricing
XM_001001615 Rosetta Predictions mouse pricing
XM_001001622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186083 predicted 2712
2 SASI_Hs01_00186084 predicted 2345
3 SASI_Hs01_00186085 predicted 1305
4 SASI_Hs01_00186086 predicted 7617
5 SASI_Hs01_00186087 predicted 7322
6 SASI_Hs02_00354022 predicted 7563
7 SASI_Hs01_00186088 predicted 951
8 SASI_Hs01_00186089 predicted 2371
9 SASI_Hs01_00186090 predicted 1891
10 SASI_Hs01_00186091 predicted 2710
11 SASI_Hs01_00186092 predicted 2591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322148 predicted 1065
2 SASI_Rn02_00322149 predicted 1690
3 SASI_Rn02_00322150 predicted 3383
4 SASI_Rn02_00322151 predicted 976
5 SASI_Rn02_00322152 predicted 6289
6 SASI_Rn02_00322153 predicted 1389
7 SASI_Rn02_00322154 predicted 3567
8 SASI_Rn02_00322155 predicted 5490
9 SASI_Rn02_00322156 predicted 1533
10 SASI_Rn02_00322157 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388509 predicted 1061
2 SASI_Rn02_00388510 predicted 1684
3 SASI_Rn02_00388511 predicted 3380
4 SASI_Rn02_00388512 predicted 969
5 SASI_Rn02_00388513 predicted 6286
6 SASI_Rn02_00388514 predicted 1388
7 SASI_Rn02_00388515 predicted 3562
8 SASI_Rn02_00388516 predicted 5486
9 SASI_Rn02_00388517 predicted 1535
10 SASI_Rn02_00388518 predicted 1708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294406 predicted 3154
2 SASI_Mm02_00294407 predicted 6410
3 SASI_Mm02_00294408 predicted 805
4 SASI_Mm02_00294409 predicted 1682
5 SASI_Mm02_00294410 predicted 976
6 SASI_Mm02_00294411 predicted 5376
7 SASI_Mm02_00294412 predicted 1389
8 SASI_Mm02_00294413 predicted 7133
9 SASI_Mm02_00294414 predicted 3569
10 SASI_Mm02_00294415 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270856 predicted 1094
2 SASI_Mm01_00270857 predicted 1226
3 SASI_Mm01_00270858 predicted 1059
4 SASI_Mm01_00270859 predicted 713
5 SASI_Mm01_00270860 predicted 951
6 SASI_Mm01_00270861 predicted 1049
7 SASI_Mm01_00270862 predicted 776
8 SASI_Mm01_00270863 predicted 1068
9 SASI_Mm01_00270864 predicted 803
10 SASI_Mm01_00270865 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216363 predicted 3475
2 SASI_Mm01_00216364 predicted 6415
3 SASI_Mm01_00216365 predicted 815
4 SASI_Mm01_00216366 predicted 1694
5 SASI_Mm01_00216367 predicted 977
6 SASI_Mm01_00216368 predicted 5378
7 SASI_Mm01_00216369 predicted 7143
8 SASI_Mm01_00216370 predicted 3572
9 SASI_Mm01_00216371 predicted 5229
10 SASI_Mm01_00216372 predicted 1261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081017
UNC79 MISSION shRNA Bacterial Glycerol Stock
unc-79 homolog (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-181s21c1
Sequence:CCGGGTGTATCATTGTCAATTATTGCTCGAGCAATAATTGACAATGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081017.1-7411s21c1
Sequence:CCGGCTTAGCAATAATGGGTATAAACTCGAGTTTATACCCATTATTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-6728s21c1
Sequence:CCGGTGGGATCCCTCACGCATAATGCTCGAGCATTATGCGTGAGGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-3584s21c1
Sequence:CCGGGTCCTCAACTCCGGCATTATTCTCGAGAATAATGCCGGAGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-5471s21c1
Sequence:CCGGCAACCGTGATGGCCGACAAATCTCGAGATTTGTCGGCCATCACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081017
UNC79 MISSION shRNA shRNA Plasmid DNA
unc-79 homolog (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-181s21c1
Sequence:CCGGGTGTATCATTGTCAATTATTGCTCGAGCAATAATTGACAATGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081017.1-7411s21c1
Sequence:CCGGCTTAGCAATAATGGGTATAAACTCGAGTTTATACCCATTATTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-6728s21c1
Sequence:CCGGTGGGATCCCTCACGCATAATGCTCGAGCATTATGCGTGAGGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-3584s21c1
Sequence:CCGGGTCCTCAACTCCGGCATTATTCTCGAGAATAATGCCGGAGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-5471s21c1
Sequence:CCGGCAACCGTGATGGCCGACAAATCTCGAGATTTGTCGGCCATCACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081017
UNC79 MISSION shRNA Lentiviral Transduction Particles
unc-79 homolog (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-181s21c1
Sequence:CCGGGTGTATCATTGTCAATTATTGCTCGAGCAATAATTGACAATGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081017.1-7411s21c1
Sequence:CCGGCTTAGCAATAATGGGTATAAACTCGAGTTTATACCCATTATTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-6728s21c1
Sequence:CCGGTGGGATCCCTCACGCATAATGCTCGAGCATTATGCGTGAGGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-3584s21c1
Sequence:CCGGGTCCTCAACTCCGGCATTATTCTCGAGAATAATGCCGGAGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081017.1-5471s21c1
Sequence:CCGGCAACCGTGATGGCCGACAAATCTCGAGATTTGTCGGCCATCACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020818
UNC79 MISSION shRNA Bacterial Glycerol Stock
unc-79 homolog (C. elegans)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-6126s21c1
Sequence:CCGGCGACGGTGATGACGGACAAATCTCGAGATTTGTCCGTCATCACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020818.3-8065s21c1
Sequence:CCGGGGTTTAGCAATAATGGGTTTACTCGAGTAAACCCATTATTGCTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-957s21c1
Sequence:CCGGTCCACTACTGGCCCAATTTAACTCGAGTTAAATTGGGCCAGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-4717s21c1
Sequence:CCGGTCCGACCCAAGCTGCGTATATCTCGAGATATACGCAGCTTGGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-1585s21c1
Sequence:CCGGTGATAACAAGGACGATGATAACTCGAGTTATCATCGTCCTTGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020818.1-8339s1c1
Sequence:CCGGGAAGCTTTCTTGCTACACATACTCGAGTATGTGTAGCAAGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020818.1-2972s1c1
Sequence:CCGGCCGGTAACATTGAGACTAATACTCGAGTATTAGTCTCAATGTTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020818.1-3655s1c1
Sequence:CCGGCCAGCTACATTTGGATTGTAACTCGAGTTACAATCCAAATGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020818
UNC79 MISSION shRNA shRNA Plasmid DNA
unc-79 homolog (C. elegans)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-6126s21c1
Sequence:CCGGCGACGGTGATGACGGACAAATCTCGAGATTTGTCCGTCATCACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020818.3-8065s21c1
Sequence:CCGGGGTTTAGCAATAATGGGTTTACTCGAGTAAACCCATTATTGCTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-957s21c1
Sequence:CCGGTCCACTACTGGCCCAATTTAACTCGAGTTAAATTGGGCCAGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-4717s21c1
Sequence:CCGGTCCGACCCAAGCTGCGTATATCTCGAGATATACGCAGCTTGGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-1585s21c1
Sequence:CCGGTGATAACAAGGACGATGATAACTCGAGTTATCATCGTCCTTGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020818.1-8339s1c1
Sequence:CCGGGAAGCTTTCTTGCTACACATACTCGAGTATGTGTAGCAAGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020818.1-2972s1c1
Sequence:CCGGCCGGTAACATTGAGACTAATACTCGAGTATTAGTCTCAATGTTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020818.1-3655s1c1
Sequence:CCGGCCAGCTACATTTGGATTGTAACTCGAGTTACAATCCAAATGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020818
UNC79 MISSION shRNA Lentiviral Transduction Particles
unc-79 homolog (C. elegans)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-6126s21c1
Sequence:CCGGCGACGGTGATGACGGACAAATCTCGAGATTTGTCCGTCATCACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020818.3-8065s21c1
Sequence:CCGGGGTTTAGCAATAATGGGTTTACTCGAGTAAACCCATTATTGCTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-957s21c1
Sequence:CCGGTCCACTACTGGCCCAATTTAACTCGAGTTAAATTGGGCCAGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-4717s21c1
Sequence:CCGGTCCGACCCAAGCTGCGTATATCTCGAGATATACGCAGCTTGGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020818.3-1585s21c1
Sequence:CCGGTGATAACAAGGACGATGATAACTCGAGTTATCATCGTCCTTGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020818.1-8339s1c1
Sequence:CCGGGAAGCTTTCTTGCTACACATACTCGAGTATGTGTAGCAAGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020818.1-2972s1c1
Sequence:CCGGCCGGTAACATTGAGACTAATACTCGAGTATTAGTCTCAATGTTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020818.1-3655s1c1
Sequence:CCGGCCAGCTACATTTGGATTGTAACTCGAGTTACAATCCAAATGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks